ID: 1129906454

View in Genome Browser
Species Human (GRCh38)
Location 15:79191033-79191055
Sequence ATTTGAAGACAAGCGTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129906447_1129906454 13 Left 1129906447 15:79190997-79191019 CCCCAGGGTCACAGTTGACCTGC No data
Right 1129906454 15:79191033-79191055 ATTTGAAGACAAGCGTCAGGTGG No data
1129906446_1129906454 19 Left 1129906446 15:79190991-79191013 CCTCGGCCCCAGGGTCACAGTTG No data
Right 1129906454 15:79191033-79191055 ATTTGAAGACAAGCGTCAGGTGG No data
1129906451_1129906454 -5 Left 1129906451 15:79191015-79191037 CCTGCACCTCTCTCTTGGATTTG No data
Right 1129906454 15:79191033-79191055 ATTTGAAGACAAGCGTCAGGTGG No data
1129906448_1129906454 12 Left 1129906448 15:79190998-79191020 CCCAGGGTCACAGTTGACCTGCA No data
Right 1129906454 15:79191033-79191055 ATTTGAAGACAAGCGTCAGGTGG No data
1129906449_1129906454 11 Left 1129906449 15:79190999-79191021 CCAGGGTCACAGTTGACCTGCAC No data
Right 1129906454 15:79191033-79191055 ATTTGAAGACAAGCGTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129906454 Original CRISPR ATTTGAAGACAAGCGTCAGG TGG Intergenic