ID: 1129906455 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:79191053-79191075 |
Sequence | TGGCTGTAACTAATGCTGAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1129906451_1129906455 | 15 | Left | 1129906451 | 15:79191015-79191037 | CCTGCACCTCTCTCTTGGATTTG | No data | ||
Right | 1129906455 | 15:79191053-79191075 | TGGCTGTAACTAATGCTGACTGG | No data | ||||
1129906452_1129906455 | 9 | Left | 1129906452 | 15:79191021-79191043 | CCTCTCTCTTGGATTTGAAGACA | No data | ||
Right | 1129906455 | 15:79191053-79191075 | TGGCTGTAACTAATGCTGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1129906455 | Original CRISPR | TGGCTGTAACTAATGCTGAC TGG | Intergenic | ||