ID: 1129906456

View in Genome Browser
Species Human (GRCh38)
Location 15:79191057-79191079
Sequence TGTAACTAATGCTGACTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129906451_1129906456 19 Left 1129906451 15:79191015-79191037 CCTGCACCTCTCTCTTGGATTTG No data
Right 1129906456 15:79191057-79191079 TGTAACTAATGCTGACTGGCAGG No data
1129906452_1129906456 13 Left 1129906452 15:79191021-79191043 CCTCTCTCTTGGATTTGAAGACA No data
Right 1129906456 15:79191057-79191079 TGTAACTAATGCTGACTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129906456 Original CRISPR TGTAACTAATGCTGACTGGC AGG Intergenic