ID: 1129906979

View in Genome Browser
Species Human (GRCh38)
Location 15:79195399-79195421
Sequence CTGTGGGCACATGCTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129906979_1129906984 -7 Left 1129906979 15:79195399-79195421 CCCTCCTCAGCATGTGCCCACAG No data
Right 1129906984 15:79195415-79195437 CCCACAGAAGCTTTCCTGATGGG No data
1129906979_1129906986 3 Left 1129906979 15:79195399-79195421 CCCTCCTCAGCATGTGCCCACAG No data
Right 1129906986 15:79195425-79195447 CTTTCCTGATGGGTAGCCCTAGG No data
1129906979_1129906982 -8 Left 1129906979 15:79195399-79195421 CCCTCCTCAGCATGTGCCCACAG No data
Right 1129906982 15:79195414-79195436 GCCCACAGAAGCTTTCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129906979 Original CRISPR CTGTGGGCACATGCTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr