ID: 1129907049

View in Genome Browser
Species Human (GRCh38)
Location 15:79195780-79195802
Sequence CAAAGTTTCCCCAAATAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129907049_1129907052 9 Left 1129907049 15:79195780-79195802 CCTGGCTATTTGGGGAAACTTTG No data
Right 1129907052 15:79195812-79195834 TCACTTATCTTGAATGTTTTGGG No data
1129907049_1129907051 8 Left 1129907049 15:79195780-79195802 CCTGGCTATTTGGGGAAACTTTG No data
Right 1129907051 15:79195811-79195833 TTCACTTATCTTGAATGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129907049 Original CRISPR CAAAGTTTCCCCAAATAGCC AGG (reversed) Intergenic
No off target data available for this crispr