ID: 1129908280

View in Genome Browser
Species Human (GRCh38)
Location 15:79205278-79205300
Sequence GACTCAGGACAGGGAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129908280_1129908289 14 Left 1129908280 15:79205278-79205300 CCTCCCTCTCCCTGTCCTGAGTC No data
Right 1129908289 15:79205315-79205337 CCCGTTATATCCCCCAACCATGG No data
1129908280_1129908291 15 Left 1129908280 15:79205278-79205300 CCTCCCTCTCCCTGTCCTGAGTC No data
Right 1129908291 15:79205316-79205338 CCGTTATATCCCCCAACCATGGG No data
1129908280_1129908292 16 Left 1129908280 15:79205278-79205300 CCTCCCTCTCCCTGTCCTGAGTC No data
Right 1129908292 15:79205317-79205339 CGTTATATCCCCCAACCATGGGG No data
1129908280_1129908293 23 Left 1129908280 15:79205278-79205300 CCTCCCTCTCCCTGTCCTGAGTC No data
Right 1129908293 15:79205324-79205346 TCCCCCAACCATGGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129908280 Original CRISPR GACTCAGGACAGGGAGAGGG AGG (reversed) Intergenic