ID: 1129908289

View in Genome Browser
Species Human (GRCh38)
Location 15:79205315-79205337
Sequence CCCGTTATATCCCCCAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129908284_1129908289 4 Left 1129908284 15:79205288-79205310 CCTGTCCTGAGTCAGTCCTTTCC No data
Right 1129908289 15:79205315-79205337 CCCGTTATATCCCCCAACCATGG No data
1129908281_1129908289 11 Left 1129908281 15:79205281-79205303 CCCTCTCCCTGTCCTGAGTCAGT No data
Right 1129908289 15:79205315-79205337 CCCGTTATATCCCCCAACCATGG No data
1129908283_1129908289 5 Left 1129908283 15:79205287-79205309 CCCTGTCCTGAGTCAGTCCTTTC No data
Right 1129908289 15:79205315-79205337 CCCGTTATATCCCCCAACCATGG No data
1129908282_1129908289 10 Left 1129908282 15:79205282-79205304 CCTCTCCCTGTCCTGAGTCAGTC No data
Right 1129908289 15:79205315-79205337 CCCGTTATATCCCCCAACCATGG No data
1129908278_1129908289 21 Left 1129908278 15:79205271-79205293 CCTCTTCCCTCCCTCTCCCTGTC No data
Right 1129908289 15:79205315-79205337 CCCGTTATATCCCCCAACCATGG No data
1129908279_1129908289 15 Left 1129908279 15:79205277-79205299 CCCTCCCTCTCCCTGTCCTGAGT No data
Right 1129908289 15:79205315-79205337 CCCGTTATATCCCCCAACCATGG No data
1129908285_1129908289 -1 Left 1129908285 15:79205293-79205315 CCTGAGTCAGTCCTTTCCACAGC No data
Right 1129908289 15:79205315-79205337 CCCGTTATATCCCCCAACCATGG No data
1129908280_1129908289 14 Left 1129908280 15:79205278-79205300 CCTCCCTCTCCCTGTCCTGAGTC No data
Right 1129908289 15:79205315-79205337 CCCGTTATATCCCCCAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129908289 Original CRISPR CCCGTTATATCCCCCAACCA TGG Intergenic
No off target data available for this crispr