ID: 1129908292

View in Genome Browser
Species Human (GRCh38)
Location 15:79205317-79205339
Sequence CGTTATATCCCCCAACCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129908283_1129908292 7 Left 1129908283 15:79205287-79205309 CCCTGTCCTGAGTCAGTCCTTTC No data
Right 1129908292 15:79205317-79205339 CGTTATATCCCCCAACCATGGGG No data
1129908286_1129908292 -10 Left 1129908286 15:79205304-79205326 CCTTTCCACAGCCCGTTATATCC No data
Right 1129908292 15:79205317-79205339 CGTTATATCCCCCAACCATGGGG No data
1129908278_1129908292 23 Left 1129908278 15:79205271-79205293 CCTCTTCCCTCCCTCTCCCTGTC No data
Right 1129908292 15:79205317-79205339 CGTTATATCCCCCAACCATGGGG No data
1129908279_1129908292 17 Left 1129908279 15:79205277-79205299 CCCTCCCTCTCCCTGTCCTGAGT No data
Right 1129908292 15:79205317-79205339 CGTTATATCCCCCAACCATGGGG No data
1129908281_1129908292 13 Left 1129908281 15:79205281-79205303 CCCTCTCCCTGTCCTGAGTCAGT No data
Right 1129908292 15:79205317-79205339 CGTTATATCCCCCAACCATGGGG No data
1129908280_1129908292 16 Left 1129908280 15:79205278-79205300 CCTCCCTCTCCCTGTCCTGAGTC No data
Right 1129908292 15:79205317-79205339 CGTTATATCCCCCAACCATGGGG No data
1129908284_1129908292 6 Left 1129908284 15:79205288-79205310 CCTGTCCTGAGTCAGTCCTTTCC No data
Right 1129908292 15:79205317-79205339 CGTTATATCCCCCAACCATGGGG No data
1129908285_1129908292 1 Left 1129908285 15:79205293-79205315 CCTGAGTCAGTCCTTTCCACAGC No data
Right 1129908292 15:79205317-79205339 CGTTATATCCCCCAACCATGGGG No data
1129908282_1129908292 12 Left 1129908282 15:79205282-79205304 CCTCTCCCTGTCCTGAGTCAGTC No data
Right 1129908292 15:79205317-79205339 CGTTATATCCCCCAACCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129908292 Original CRISPR CGTTATATCCCCCAACCATG GGG Intergenic
No off target data available for this crispr