ID: 1129908558

View in Genome Browser
Species Human (GRCh38)
Location 15:79207232-79207254
Sequence CTGTAGACATTGAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129908558_1129908564 -3 Left 1129908558 15:79207232-79207254 CCCTCTCCCCTCAATGTCTACAG No data
Right 1129908564 15:79207252-79207274 CAGCAGTCCCTGGCAATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129908558 Original CRISPR CTGTAGACATTGAGGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr