ID: 1129909295

View in Genome Browser
Species Human (GRCh38)
Location 15:79212869-79212891
Sequence CTGTCTACAGAGACCCAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129909286_1129909295 27 Left 1129909286 15:79212819-79212841 CCAGGGCTCATCACACAGGGTCA No data
Right 1129909295 15:79212869-79212891 CTGTCTACAGAGACCCAGCCGGG No data
1129909292_1129909295 -9 Left 1129909292 15:79212855-79212877 CCTCGCATGATCCACTGTCTACA No data
Right 1129909295 15:79212869-79212891 CTGTCTACAGAGACCCAGCCGGG No data
1129909285_1129909295 28 Left 1129909285 15:79212818-79212840 CCCAGGGCTCATCACACAGGGTC No data
Right 1129909295 15:79212869-79212891 CTGTCTACAGAGACCCAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129909295 Original CRISPR CTGTCTACAGAGACCCAGCC GGG Intergenic
No off target data available for this crispr