ID: 1129913963

View in Genome Browser
Species Human (GRCh38)
Location 15:79251621-79251643
Sequence GAGGCTAAACACGGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129913963_1129913971 23 Left 1129913963 15:79251621-79251643 CCCTCCTCACCGTGTTTAGCCTC No data
Right 1129913971 15:79251667-79251689 ACTGCTTCTTCTGCTATGCATGG No data
1129913963_1129913967 -8 Left 1129913963 15:79251621-79251643 CCCTCCTCACCGTGTTTAGCCTC No data
Right 1129913967 15:79251636-79251658 TTAGCCTCAACTCCCATGTCAGG No data
1129913963_1129913972 24 Left 1129913963 15:79251621-79251643 CCCTCCTCACCGTGTTTAGCCTC No data
Right 1129913972 15:79251668-79251690 CTGCTTCTTCTGCTATGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129913963 Original CRISPR GAGGCTAAACACGGTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr