ID: 1129913963 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:79251621-79251643 |
Sequence | GAGGCTAAACACGGTGAGGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1129913963_1129913971 | 23 | Left | 1129913963 | 15:79251621-79251643 | CCCTCCTCACCGTGTTTAGCCTC | No data | ||
Right | 1129913971 | 15:79251667-79251689 | ACTGCTTCTTCTGCTATGCATGG | No data | ||||
1129913963_1129913967 | -8 | Left | 1129913963 | 15:79251621-79251643 | CCCTCCTCACCGTGTTTAGCCTC | No data | ||
Right | 1129913967 | 15:79251636-79251658 | TTAGCCTCAACTCCCATGTCAGG | No data | ||||
1129913963_1129913972 | 24 | Left | 1129913963 | 15:79251621-79251643 | CCCTCCTCACCGTGTTTAGCCTC | No data | ||
Right | 1129913972 | 15:79251668-79251690 | CTGCTTCTTCTGCTATGCATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1129913963 | Original CRISPR | GAGGCTAAACACGGTGAGGA GGG (reversed) | Intergenic | ||
No off target data available for this crispr |