ID: 1129915558

View in Genome Browser
Species Human (GRCh38)
Location 15:79266901-79266923
Sequence CCACACCCAGAGGTGGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129915558_1129915564 9 Left 1129915558 15:79266901-79266923 CCCTGTACCACCTCTGGGTGTGG No data
Right 1129915564 15:79266933-79266955 TCCTGCTCCTCTGGAAAAGTCGG No data
1129915558_1129915563 0 Left 1129915558 15:79266901-79266923 CCCTGTACCACCTCTGGGTGTGG No data
Right 1129915563 15:79266924-79266946 ACACTTTCATCCTGCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129915558 Original CRISPR CCACACCCAGAGGTGGTACA GGG (reversed) Intergenic
No off target data available for this crispr