ID: 1129918431

View in Genome Browser
Species Human (GRCh38)
Location 15:79295609-79295631
Sequence CTGTGTCAGGGGACGGGTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129918431_1129918440 26 Left 1129918431 15:79295609-79295631 CCCAGACCCGTCCCCTGACACAG 0: 1
1: 0
2: 0
3: 23
4: 253
Right 1129918440 15:79295658-79295680 ACAGTCAAGGTTAACTAACTTGG 0: 1
1: 0
2: 0
3: 9
4: 86
1129918431_1129918439 13 Left 1129918431 15:79295609-79295631 CCCAGACCCGTCCCCTGACACAG 0: 1
1: 0
2: 0
3: 23
4: 253
Right 1129918439 15:79295645-79295667 AATCTTGTGAAAAACAGTCAAGG 0: 1
1: 0
2: 3
3: 29
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129918431 Original CRISPR CTGTGTCAGGGGACGGGTCT GGG (reversed) Exonic
900157938 1:1211043-1211065 CTGTGGCTGGAGAGGGGTCTTGG - Intergenic
900157949 1:1211086-1211108 CTGTGGCTGGAGAGGGGTCTTGG - Intergenic
900185657 1:1331992-1332014 CTGTGTCAGGAGATGCCTCTTGG + Intronic
900270536 1:1785040-1785062 CTATGCCTGGGGAGGGGTCTGGG + Intergenic
900479316 1:2890393-2890415 ATGGGTCAGGGCCCGGGTCTGGG + Intergenic
900541652 1:3205956-3205978 CTGAGTCAGGGCAGGGGGCTGGG - Intronic
900860156 1:5223186-5223208 CTGTGGCAGAGGAAGGGTCCAGG + Intergenic
902981572 1:20127111-20127133 CTGTGGCATGGGATGGGACTGGG + Intergenic
904490534 1:30856204-30856226 CTGTCTCAGGGGAAGGGTTGAGG - Intergenic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
906033957 1:42739647-42739669 CTGTGGGAGGGGAGGGCTCTAGG - Intronic
906052631 1:42887644-42887666 CTGTGTCTGGGGACTGCGCTGGG - Intergenic
906830225 1:49023272-49023294 CTGTGTCAAGGTTCAGGTCTGGG + Intronic
911684117 1:100754635-100754657 GTGTGCCAGTGGAAGGGTCTGGG + Intergenic
913937236 1:125065929-125065951 CTGTGTCTGGGGCTGGGGCTGGG - Intergenic
913972957 1:143430018-143430040 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
914067341 1:144255625-144255647 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
914111812 1:144710729-144710751 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
916128049 1:161588846-161588868 CTCTGTCAGGGAACAGGCCTTGG - Intronic
916137967 1:161670676-161670698 CTCTGTCAGGGAACAGGCCTTGG - Intronic
916877796 1:168988264-168988286 GTGTGTGAGGGGATGGGACTGGG - Intergenic
917070908 1:171149586-171149608 CTGGGTCATGAGTCGGGTCTGGG + Exonic
917459205 1:175214573-175214595 CTGTGGCAGGGGACAGGGGTGGG + Intergenic
917779182 1:178373467-178373489 ATGTGTCAGGGGAGGGGAATGGG - Intronic
920836897 1:209519556-209519578 TGGTTTCAGGGGACAGGTCTGGG + Intergenic
920909897 1:210206541-210206563 CTATGTCAGAGGAGGGGCCTGGG + Intergenic
921230728 1:213067549-213067571 CAGTGTCATGGGAAGGATCTAGG + Intronic
922336749 1:224624376-224624398 CAGTGTCGGGGGACAGGTCTGGG - Intronic
922680944 1:227595357-227595379 CTGTGTAAGGGAACTGGTCTGGG + Intronic
922855357 1:228770400-228770422 CTGTGTCAGTGGAAGGGTGCAGG + Intergenic
923255051 1:232214655-232214677 TTGTGTCAGGGGATGGGACGGGG + Intergenic
923808565 1:237287940-237287962 CTCTGTCAGAGGGAGGGTCTAGG + Intronic
924220695 1:241872501-241872523 CTGTGGCAGGGTAGGGGGCTAGG - Intronic
1062760900 10:17795-17817 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
1065625473 10:27624928-27624950 CTGGTTAAGGGGAGGGGTCTGGG - Intergenic
1066747184 10:38612284-38612306 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
1067065752 10:43103155-43103177 CTGGGGCAGGGGGCAGGTCTGGG + Intronic
1068675962 10:59770128-59770150 CTGTGTACGGGAACTGGTCTGGG + Intergenic
1068686100 10:59871512-59871534 GTTTGTCAGGGCAAGGGTCTGGG - Intronic
1069242620 10:66162334-66162356 CTCTGTCAGGGGGAGGGTCTAGG + Intronic
1071016060 10:80998246-80998268 CTGTTTCAGGGTATGGTTCTTGG + Intergenic
1072201947 10:93168181-93168203 ATGTGTCAGAGGAGGGGTATGGG - Intergenic
1072909910 10:99491178-99491200 CTGTGTCAGGGGAGGGGTTGGGG - Intergenic
1073207449 10:101776342-101776364 CTGGGCTAGGGGAGGGGTCTGGG + Intronic
1074722466 10:116274236-116274258 CTGGGTCGGGAGACCGGTCTAGG + Intergenic
1076022913 10:127089188-127089210 CTGAGTCACGGGAGGGGTCCAGG - Intronic
1076248625 10:128967091-128967113 CTGTGTTGGGGTACGGGTCTGGG - Intergenic
1077239151 11:1501637-1501659 CTGTGCCAAGGGAAGGGACTGGG + Intergenic
1078672304 11:13376318-13376340 CTGTGTGAGGGGCCGGGGCTAGG + Intronic
1079856551 11:25612154-25612176 CTATGTCAGAGGGAGGGTCTGGG + Intergenic
1080152940 11:29075724-29075746 CTGTGTCAGAGGGAAGGTCTAGG + Intergenic
1080886064 11:36369416-36369438 CTGTATCAGGTGACTGGTCCTGG - Intronic
1081622690 11:44628293-44628315 CTGGGTCAGGGGTGGGCTCTGGG - Intergenic
1081683538 11:45025748-45025770 ATGGTTCAGGGGATGGGTCTAGG + Intergenic
1085034940 11:73293965-73293987 CTGTGTGAGGAGAGGGGTCAGGG + Intronic
1085452157 11:76640917-76640939 CTGTGTCAGAAGAGGGATCTAGG - Intergenic
1086300595 11:85423070-85423092 CTGTGTCAGAGGGAAGGTCTAGG + Intronic
1086669926 11:89533868-89533890 CTGTTTCAGGGGAAGGATGTGGG - Intergenic
1086983477 11:93223836-93223858 CAGTGTCAGGGGCTGGGTCATGG + Intergenic
1087634808 11:100690026-100690048 CTATGCCAGGGGACATGTCTGGG - Intronic
1088179564 11:107093243-107093265 CTGTGTCAGCGGGAAGGTCTAGG - Intergenic
1089597507 11:119590276-119590298 CGGTGTCAGGGGACTGGTGTGGG - Intergenic
1089966079 11:122655957-122655979 CTGGGCCAGGGGAGGGGGCTCGG - Exonic
1091345186 11:134847585-134847607 ATGTGTGAGGGGAGGGGTCCCGG + Intergenic
1092041925 12:5392970-5392992 ATGTGTCAGGAGAGGGATCTGGG - Intergenic
1092125627 12:6073287-6073309 GTGTGTCAGGGAACCGATCTGGG - Intronic
1094808633 12:34115498-34115520 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
1095118142 12:38381279-38381301 CTCTGTCAGGGGGAAGGTCTAGG + Intergenic
1099954794 12:89343301-89343323 CTCTGCCAGGGGCCGGGGCTGGG - Intergenic
1101730672 12:107424685-107424707 CTGGGTCAGGAGAGGAGTCTGGG - Intronic
1104650417 12:130527313-130527335 CAGTGTCGGGGGAGGGTTCTGGG + Intronic
1104929488 12:132330088-132330110 CTGAGTCCCGGGACGGGTATGGG + Intergenic
1107629985 13:42333607-42333629 CTGTGTCAGGAGACGGGGCGGGG - Intergenic
1107666147 13:42693292-42693314 CTCTGTCAGAGGGAGGGTCTAGG + Intergenic
1108825635 13:54408789-54408811 CTGTGTCAGAGGGAAGGTCTAGG - Intergenic
1109301076 13:60590817-60590839 CTGTGTCTGGGTCTGGGTCTGGG - Intergenic
1112180170 13:97070404-97070426 CTGTGACAGAGGACGGTGCTGGG - Intergenic
1113269852 13:108661913-108661935 CTCTGTCAGAGGAAAGGTCTAGG + Intronic
1113848500 13:113405160-113405182 CTGTGTCAGGGGACGCTCCTGGG + Intergenic
1114030700 14:18577516-18577538 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
1114562318 14:23602329-23602351 CTCTGTCAGGGGAGGGGTGCCGG - Intergenic
1114614806 14:24062704-24062726 CTGGGTCAGGTGCCGGGCCTGGG - Exonic
1115969901 14:38933138-38933160 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
1120544922 14:85799312-85799334 CTGTTTAAGGGGACTGGACTGGG + Intergenic
1121570687 14:94944568-94944590 CTGTGTTAGGGGGCAGGCCTTGG + Intergenic
1122001830 14:98664803-98664825 GTGTGTCAGAGGAGGGTTCTCGG - Intergenic
1122119511 14:99544565-99544587 CTGAGGCAGGGGATGGGGCTTGG + Intronic
1122123928 14:99569117-99569139 CTAGGTCTGGGGACGGGGCTTGG - Intronic
1122269868 14:100564075-100564097 CTGTCTGTGGGGAAGGGTCTCGG + Intronic
1122269888 14:100564132-100564154 CTGTCTGTGGGGAAGGGTCTCGG + Intronic
1122302836 14:100740856-100740878 CTGTGTCAGGGTCCTGGACTGGG - Intergenic
1124651824 15:31479682-31479704 CTGTCTCTGGGGAGGGGTCATGG - Exonic
1125725277 15:41865222-41865244 ATGTGTGAGGGGGCGGGTGTGGG + Intronic
1128778996 15:70345531-70345553 CTTTCTCAGGGGCTGGGTCTTGG + Intergenic
1129365208 15:75049804-75049826 GTGTGGCTGGGGAAGGGTCTGGG + Exonic
1129918431 15:79295609-79295631 CTGTGTCAGGGGACGGGTCTGGG - Exonic
1131118662 15:89809603-89809625 CTGTGGCAGGGGACTGGACGAGG - Intronic
1131326754 15:91455649-91455671 CTGTGTCAGAGGGAAGGTCTAGG + Intergenic
1132663558 16:1071927-1071949 CAGAGTCAGGGGAGGGGGCTGGG + Intergenic
1132990747 16:2791621-2791643 CTGAGACAGGGGTTGGGTCTGGG - Intergenic
1136735882 16:32467360-32467382 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
1138418613 16:56885435-56885457 CTGGGTCAGGTGACAGGTCTAGG - Intronic
1138437363 16:57010999-57011021 TTGTGTCTGAGGAGGGGTCTGGG - Intronic
1139632682 16:68239996-68240018 CTGAGAGCGGGGACGGGTCTGGG - Intergenic
1141443871 16:84045767-84045789 CCGTGTCAGGTGACAGGCCTAGG + Intergenic
1141701931 16:85646608-85646630 CTGTGTCAGGGAAGGGGGCTTGG + Intronic
1142205876 16:88782930-88782952 CTGTGTCTGGGGATGGGGCGTGG - Intronic
1142284698 16:89167005-89167027 CTGTGGCTGGGGATGGGGCTGGG - Intergenic
1203017193 16_KI270728v1_random:362214-362236 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
1203035528 16_KI270728v1_random:635372-635394 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
1143672502 17:8406160-8406182 CTGTGTCAGGGCACATGGCTTGG + Intergenic
1143990919 17:10960447-10960469 CTCTGTCAGGGGGAAGGTCTAGG - Intergenic
1145275936 17:21430487-21430509 CTGTGTCAGGGAACTGTCCTAGG - Intergenic
1145306325 17:21677268-21677290 CTGGGTCTGGGGCTGGGTCTGGG - Intergenic
1145313782 17:21716400-21716422 CTGTGTCAGGGAACTGTCCTAGG - Intergenic
1147810470 17:43166363-43166385 CTCTGTAAGGGAACTGGTCTGGG + Intergenic
1148756506 17:49975871-49975893 CAGTGTCTGGGAACAGGTCTAGG - Intergenic
1150711594 17:67535021-67535043 CACTGTCAGGACACGGGTCTGGG - Intronic
1150945592 17:69742658-69742680 CTCTGTCAGGGGGAAGGTCTAGG + Intergenic
1151364362 17:73607511-73607533 CTGAGCCAGGGAAGGGGTCTCGG + Intronic
1152067912 17:78121599-78121621 CTGTGTCTGGGGACCGCGCTGGG - Exonic
1152953807 18:18149-18171 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
1153168888 18:2292947-2292969 CTGTGTCAGAGGGAAGGTCTAGG + Intergenic
1153392219 18:4574884-4574906 ATGTGTCAGGGGAGGGACCTGGG + Intergenic
1156077709 18:33301053-33301075 CTGTTTCAGGGGGCAGGCCTGGG + Intronic
1156944754 18:42815033-42815055 CTGTGTCAGAGAAACGGTCTAGG - Intronic
1157551055 18:48582198-48582220 CAGTGTCAGAGGAAGGGTCCTGG + Intronic
1160569375 18:79806295-79806317 CTGTGTCGGGGGTCGGGGCATGG + Intergenic
1160943102 19:1629250-1629272 CTGTCCCAGGGGACAGGCCTGGG + Intronic
1161648130 19:5467035-5467057 CTGAGCCTGGGGACGGGGCTCGG - Intergenic
1162027264 19:7901456-7901478 GTGTTTCAGGGGAGGGGACTGGG - Exonic
1162559315 19:11406635-11406657 CTGGGCCAGGGGAGGGGTGTGGG + Intronic
1163439701 19:17315870-17315892 CAGTGTCAGGGGAGGAGCCTGGG + Intronic
1165487196 19:36103092-36103114 CTCCGTCAGGGCACGGGGCTGGG + Intronic
1166139548 19:40798940-40798962 CAGTGTGAGGGGCCGGGTCTGGG - Intronic
1166267296 19:41692142-41692164 CTGTCTCTGAGGAGGGGTCTGGG - Intronic
1167052723 19:47089601-47089623 CTTTGTCAGGTGATGGGGCTGGG + Intronic
1167096896 19:47379497-47379519 CTGAGTCAGGGAAGGGGGCTGGG - Intronic
1167482908 19:49744217-49744239 CTGTGCCAGGTAACGGGGCTGGG - Exonic
925130318 2:1489604-1489626 CTGTGCCAGTCGACGGTTCTGGG - Intronic
928315015 2:30238158-30238180 CTCTGTCTGGGGAAGGGTCTTGG + Intronic
933610494 2:84429494-84429516 CTGTGCCAGGGGACTGGGCAGGG + Intronic
934187049 2:89756472-89756494 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
934775107 2:96932336-96932358 CAGTGTCAGAGGAGGGGCCTGGG + Intronic
937521883 2:122721505-122721527 CTGTGTCAGAGGGAAGGTCTAGG - Intergenic
938287345 2:130128965-130128987 CTGTGTCAGGGGGCTGGTTGGGG - Intronic
938428247 2:131209904-131209926 CTGTGTCAGGGGGCTGGTTGGGG + Intronic
938469154 2:131543908-131543930 CTGTGTCAGGGGGCTGGTTGGGG + Intergenic
938497510 2:131808250-131808272 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
940034625 2:149301192-149301214 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
940217618 2:151316365-151316387 CTATGTCAGAGGAAAGGTCTAGG - Intergenic
941753001 2:169152927-169152949 CTGTGCGAGGGGAGGGCTCTAGG - Exonic
942889133 2:180965537-180965559 CTGTGTCAGGGGGTGGGGGTAGG + Intergenic
945170256 2:206988319-206988341 GTGTTCCAGGGGATGGGTCTGGG + Intergenic
946327477 2:218992353-218992375 GGGTGTCAGGGGAAGGGTTTGGG - Intronic
947456987 2:230264602-230264624 CTCTGTCAGAGGGAGGGTCTAGG + Intronic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
948449564 2:238060852-238060874 CTGGGTCAGGTGACGGGTGGGGG - Intronic
948674819 2:239591114-239591136 CTCCGTCAGGGCACGGGGCTGGG - Intergenic
1173928330 20:46797633-46797655 CTTTGTCGGGGGACAAGTCTGGG + Intergenic
1176375899 21:6086742-6086764 CTGGGTCAGGAGACCGGTCGGGG + Intergenic
1179747576 21:43451502-43451524 CTGGGTCAGGAGACCGGTCGGGG - Intergenic
1179890254 21:44331576-44331598 CTGTGCCAGGGCACGGGGCCTGG + Intronic
1180454814 22:15504572-15504594 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
1180536680 22:16398592-16398614 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
1181359276 22:22322565-22322587 CAGGGTCAGGGGAGGGGTCCAGG + Intergenic
1181369377 22:22404317-22404339 CAGGGTCAGGGGAGGGGTCCAGG + Intergenic
1181371130 22:22417640-22417662 CTCTGTCAGAGGAGAGGTCTAGG - Intergenic
1183347801 22:37317557-37317579 CTGTGTCAGGGCACGGGGCGGGG + Intergenic
1183752702 22:39731068-39731090 CTGTGCTAGGGGAGGGGGCTGGG + Intergenic
1184864914 22:47197029-47197051 CTGTGCACAGGGACGGGTCTGGG - Intergenic
1185183550 22:49378554-49378576 CTGTGTCAGGTGTAGGGTGTGGG + Intergenic
1185419985 22:50729815-50729837 CTGTGTCAGGGGAAGCCTCAAGG - Intergenic
950410322 3:12831947-12831969 CTGGGTCAGATGACTGGTCTAGG + Intronic
950423958 3:12914708-12914730 CTATGGCAGAGGACGGGTCCTGG + Intronic
950423997 3:12914840-12914862 CTGTTTCAGGCGCAGGGTCTGGG + Intronic
950603460 3:14057269-14057291 CTCTGTCAGAGGAAAGGTCTAGG + Intronic
951084193 3:18491662-18491684 CTGTGTCAGGTGGTGTGTCTGGG + Intergenic
951764143 3:26178583-26178605 CTCTGTCAGAGGGAGGGTCTAGG + Intergenic
952122804 3:30264620-30264642 CTGTGTCAGAGGAAAGATCTGGG - Intergenic
952689760 3:36191589-36191611 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
953408488 3:42673139-42673161 CTGTGTCAGAAGAGGGGCCTTGG + Intergenic
954000691 3:47554475-47554497 TTGTGTCAGGGCAGGGTTCTGGG + Intergenic
954080280 3:48209541-48209563 CAGTGTCAGGGGAGGAATCTGGG - Intergenic
957281424 3:78155322-78155344 CTGTTTCATGTGAAGGGTCTTGG + Intergenic
958593086 3:96185238-96185260 CTGTGTTGGGGGGCGGGTGTTGG + Intergenic
958770762 3:98422483-98422505 CTCTGTCAGAGGAAAGGTCTAGG - Intergenic
958969847 3:100600101-100600123 CTCTGTCAGGGGGAAGGTCTAGG + Intergenic
961762866 3:129184196-129184218 GGATGCCAGGGGACGGGTCTCGG + Intergenic
961893393 3:130148460-130148482 CTATGTATGGGAACGGGTCTGGG + Intergenic
962256148 3:133871597-133871619 CAGTGTCAGTGGAGGAGTCTGGG - Intronic
962504856 3:136036347-136036369 CTCTGTCAGAGGAAAGGTCTAGG + Intronic
963974091 3:151461097-151461119 CTGTGTCTGGGGACGCGGCCGGG + Intergenic
964202544 3:154134333-154134355 CTGTGTCTGGGGAGGACTCTGGG + Intronic
964518002 3:157533639-157533661 GTGTGTCAGAGGAGAGGTCTGGG - Intergenic
964522940 3:157586758-157586780 CTGTGTATGGGAACTGGTCTGGG + Intronic
965132736 3:164722950-164722972 CTATGTCAGAGGAAGGATCTGGG + Intergenic
968562972 4:1294783-1294805 CAGTGGCAGGGGACGGGGGTGGG + Intronic
968869498 4:3234494-3234516 CTGTGTCTGGGGCCTGTTCTGGG - Intronic
969707103 4:8817989-8818011 CTGTCTCTGGGGACAGGCCTGGG - Intergenic
977733304 4:100380499-100380521 CTGTGTCAGAGGGAAGGTCTGGG - Intergenic
978316859 4:107447804-107447826 CTCTGTCAGGGGGAAGGTCTAGG + Intergenic
980892167 4:138827569-138827591 CTGTGTCTGTGGAGGGGCCTGGG - Intergenic
983119492 4:163863637-163863659 CTGTGTCACTTGACGGGTCCCGG + Intronic
983441392 4:167790995-167791017 CTGTGTCAGGGGGCCGGGCGCGG - Intergenic
984538511 4:181007046-181007068 CCCTGTCAGGGGAGAGGTCTGGG - Intergenic
985288651 4:188363227-188363249 CTGTGTCAGAGGGAAGGTCTGGG - Intergenic
990899653 5:60736997-60737019 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
994306779 5:98214604-98214626 CTCTGTAAGGGGTGGGGTCTGGG + Intergenic
995694513 5:114864991-114865013 CTCTGTCAGAGGAAGGGTCTAGG + Intergenic
997105890 5:131019219-131019241 CTTTGTCAGGGGGAAGGTCTAGG + Intergenic
997571940 5:134936295-134936317 CTGTGTGAGAGGCCGGGGCTGGG - Intronic
998179432 5:139926096-139926118 CTGTGTCAGAGGAAGGCCCTAGG - Intronic
998874546 5:146586200-146586222 CTGTGTCAGGGGATTTGTTTTGG + Intronic
999420617 5:151439237-151439259 ATGTGTCAAGGGAGGGGCCTGGG - Intronic
999677182 5:154015634-154015656 CTGTGTCAGAGGAAAGGTCTAGG - Intronic
1001855155 5:175004319-175004341 CTGTGTCATGGGAGGGACCTGGG + Intergenic
1006885970 6:37382565-37382587 CTGAGTCGGGGGACGGGGTTGGG + Intronic
1007317726 6:41002902-41002924 CTGTGTCAGAGGACTGTTCTCGG + Intergenic
1009493769 6:64325426-64325448 CTCTGTCAGAGGAAAGGTCTAGG - Intronic
1010045381 6:71436886-71436908 CTGTGTCAGAGGGAAGGTCTAGG - Intergenic
1011535853 6:88375284-88375306 CTCTGGCAGGGGAAGGGTCCTGG + Intergenic
1011968817 6:93195819-93195841 CTGTGTCTGGGGATAGTTCTAGG + Intergenic
1013221227 6:108079778-108079800 CTGTGTCAGAGGGAAGGTCTAGG + Intronic
1015175039 6:130296930-130296952 AAGTGTCAGGGGAAGGGGCTGGG - Intronic
1018920208 6:168167367-168167389 ATGTGTCAAGGGAGGGGCCTGGG - Intergenic
1019088535 6:169503523-169503545 TAGTGTCTGGGGACGGCTCTTGG - Intronic
1019547819 7:1586956-1586978 CTGAGGGAGGGGACGGGTCCTGG - Intergenic
1022290734 7:29000301-29000323 ATGTGTCAGGGGAAGCTTCTTGG + Intronic
1023039069 7:36156342-36156364 CTGGGTCAGGGAACTGGACTGGG + Intronic
1023915043 7:44582356-44582378 CTGTGTGAGGGGGCGGGGCGCGG - Intergenic
1024987967 7:55212284-55212306 GTGTGGCAGGGGAGGGTTCTAGG + Intronic
1025150908 7:56548604-56548626 CAGAGTCTGGGGAAGGGTCTGGG + Intergenic
1025262299 7:57427053-57427075 CTGTCTCAGAGGAGGGGTCCTGG + Intergenic
1025737922 7:64169587-64169609 CAGAGTCTGGGGATGGGTCTGGG - Intronic
1025739650 7:64184296-64184318 CTGTCTCAGAGGAGGGGTCCTGG + Intronic
1025766180 7:64453649-64453671 CAGAGTCTGGGGAGGGGTCTGGG - Intergenic
1026000982 7:66558610-66558632 CTGTCTCAGAGGAGGGGTCCTGG + Intergenic
1028648063 7:93120217-93120239 CTGTGTCAGGGGGAAGATCTGGG - Intergenic
1029110359 7:98210826-98210848 CTGTGTCAGGGGGAGGGTCGGGG + Intergenic
1030656635 7:112175156-112175178 ATGTTCCAGGGGACGGGGCTGGG - Intronic
1033142515 7:138840253-138840275 CTGTGTCAGGTGCTGGATCTGGG + Exonic
1034426237 7:151015714-151015736 CTGTGGGAGGAGACGGCTCTTGG + Intronic
1036748411 8:11426999-11427021 CTGTTTTAGGGTACAGGTCTGGG + Intronic
1038367117 8:26947875-26947897 CTCTGTCAGAGGAAAGGTCTAGG + Intergenic
1040444846 8:47483036-47483058 CAGAGTCAGGGGACAGGTCTGGG + Intronic
1040635580 8:49269925-49269947 CTGTGTCAGGGGGAAGGTCTAGG + Intergenic
1040697460 8:50019047-50019069 CTGGGTCTGGGGAAGGGTCAAGG + Intronic
1040701243 8:50068552-50068574 CTAGCTCAGGGGAAGGGTCTAGG - Intronic
1041011860 8:53551469-53551491 CTGTGTGAAGGGACAGGACTGGG + Intergenic
1041150424 8:54926474-54926496 CTGTGTCAGAGGGAAGGTCTAGG - Intergenic
1045412432 8:101932190-101932212 CTGTGGCAGGGGAGGGGGCCTGG - Intronic
1051911150 9:22154782-22154804 CTGTCTCAGAGGAGGGGTCCTGG + Intergenic
1057367549 9:94437180-94437202 GTGTGTCAGGAGCCGGGTTTTGG + Intronic
1057504895 9:95626005-95626027 TGGTGTATGGGGACGGGTCTTGG + Intergenic
1057655779 9:96950873-96950895 GTGTGTCAGGAGCCGGGTTTTGG - Intronic
1059451360 9:114373072-114373094 CTGTGGCAGGGGCAGGGTCCTGG + Intronic
1060530102 9:124342968-124342990 CTGAGGCAGGGAACGGGGCTGGG - Intronic
1060739103 9:126086272-126086294 CTGTGTCAGGGACCCTGTCTTGG - Intergenic
1062013241 9:134277976-134277998 CTGTGGCAGGGCAGGGGACTTGG + Intergenic
1062360412 9:136185537-136185559 CAGTGACAGGGGGCGGGTCTGGG + Intergenic
1062521295 9:136959046-136959068 CTGCACCAGGGGACGGGGCTGGG + Intergenic
1203431277 Un_GL000195v1:93225-93247 CTGTGTCAGCAAACGGCTCTGGG - Intergenic
1190063406 X:47224784-47224806 CTGGCTCAGGAGAAGGGTCTGGG - Intronic
1190212893 X:48461584-48461606 TTGTGTCATGGGAGGGGTTTGGG - Intronic
1190632106 X:52398338-52398360 CTCTGTCAGAGGGAGGGTCTAGG + Intergenic
1192157764 X:68759108-68759130 CTTTGAAAGGGGACGGGGCTAGG + Intergenic
1192236696 X:69300666-69300688 CTGTGTCAGGGTCCTGGTCCTGG - Intergenic
1192944931 X:75956588-75956610 CTATGTCAGAGGAAAGGTCTAGG + Intergenic
1192968092 X:76201812-76201834 CTCTGTCAGAGGAGAGGTCTAGG + Intergenic
1195864024 X:109410007-109410029 CTGTGGCAGGGGGCAGGGCTGGG - Intronic
1197865083 X:131009022-131009044 AAGTGTCAGGGGAGGGGTCTGGG + Intergenic
1199987073 X:152960175-152960197 CTGGGTCAGGGGAGGGATATAGG + Intronic
1202174414 Y:22084592-22084614 CTGGGTCAGGGGCCAGGTTTGGG - Intronic
1202216946 Y:22501790-22501812 CTGGGTCAGGGGCCAGGTTTGGG + Intronic
1202326241 Y:23694280-23694302 CTGGGTCAGGGGCCAGGTTTGGG - Intergenic
1202544531 Y:25975774-25975796 CTGGGTCAGGGGCCAGGTTTGGG + Intergenic