ID: 1129919767

View in Genome Browser
Species Human (GRCh38)
Location 15:79310684-79310706
Sequence CCTAACATCCACAGTAGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129919767_1129919777 21 Left 1129919767 15:79310684-79310706 CCCTAACTACTGTGGATGTTAGG No data
Right 1129919777 15:79310728-79310750 ACAAGGAGACTGGTTCTCGAGGG No data
1129919767_1129919775 11 Left 1129919767 15:79310684-79310706 CCCTAACTACTGTGGATGTTAGG No data
Right 1129919775 15:79310718-79310740 CCATTTCAAGACAAGGAGACTGG No data
1129919767_1129919772 4 Left 1129919767 15:79310684-79310706 CCCTAACTACTGTGGATGTTAGG No data
Right 1129919772 15:79310711-79310733 GGCACACCCATTTCAAGACAAGG No data
1129919767_1129919776 20 Left 1129919767 15:79310684-79310706 CCCTAACTACTGTGGATGTTAGG No data
Right 1129919776 15:79310727-79310749 GACAAGGAGACTGGTTCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129919767 Original CRISPR CCTAACATCCACAGTAGTTA GGG (reversed) Intergenic
No off target data available for this crispr