ID: 1129923941

View in Genome Browser
Species Human (GRCh38)
Location 15:79345294-79345316
Sequence CAGAGGGTGAAGGGTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1358
Summary {0: 1, 1: 0, 2: 19, 3: 164, 4: 1174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129923941 Original CRISPR CAGAGGGTGAAGGGTGGGAA GGG (reversed) Intronic
900076959 1:825696-825718 CACAGGGTCATGGGTGAGAATGG + Intergenic
900108512 1:996304-996326 CACAGGATGCAGGGTGGGGAGGG + Intergenic
900108537 1:996370-996392 CACAGGATGCAGGGTGGGGAGGG + Intergenic
900108588 1:996502-996524 CACAGGATGCAGGGTGGGGAGGG + Intergenic
900108637 1:996634-996656 CACAGGATGCAGGGTGGGGAGGG + Intergenic
900108662 1:996700-996722 CACAGGATGCAGGGTGGGGAGGG + Intergenic
900108686 1:996765-996787 CACAGGATGCAGGGTGGGGAGGG + Intergenic
900108711 1:996831-996853 CACAGGATGCAGGGTGGGGAGGG + Intergenic
900320921 1:2083252-2083274 CAGAGGCTGCAGGGAGGGACAGG - Intronic
900672821 1:3866320-3866342 CAGAGGGTGCAGGGAGGCAGAGG - Intronic
900906397 1:5562678-5562700 CAGAGGGGGAAGTGTGGGGTTGG - Intergenic
901156986 1:7146687-7146709 CAGAGGGGGTAGGGAGAGAAGGG + Intronic
901490540 1:9594334-9594356 CAGGGGGTGTGGGGTGAGAAGGG + Intronic
901807865 1:11749355-11749377 CAGCTGGTTGAGGGTGGGAATGG + Intronic
901813502 1:11780801-11780823 GAGAGGTTGAGGCGTGGGAAGGG + Intronic
902208997 1:14891307-14891329 CTCAGGGTAAAGGGTGGGAAGGG - Intronic
902802812 1:18840832-18840854 CAGAGGGTGAGGTCTTGGAAGGG - Intronic
902870407 1:19310843-19310865 CAGTGGGTGAAGCATGGTAAGGG + Intronic
903269648 1:22179282-22179304 CAGAGGGGGCGGGGTGGAAAAGG + Intergenic
903372817 1:22847786-22847808 CACAGGGTGTATGGGGGGAAGGG - Intronic
903407079 1:23106817-23106839 CAGACTGTGGAGGGTGGGGAAGG - Intronic
904294200 1:29507200-29507222 CAGAGGGTGAGGGGTAATAATGG - Intergenic
904392103 1:30192808-30192830 TTGAGGGTGAAGAGAGGGAAAGG + Intergenic
904564298 1:31418723-31418745 CATAGGGTGTTGGGTGGGTAAGG - Intronic
904575655 1:31503553-31503575 CCGAAGCTCAAGGGTGGGAAGGG + Intergenic
904604333 1:31690636-31690658 CAGAGGGGCACGGGTGGGGAAGG - Intronic
904615691 1:31748359-31748381 CTGAGTGGGATGGGTGGGAATGG - Intronic
904669713 1:32154496-32154518 GGGAGGGTGAAGGGTGGGTAGGG + Intronic
904810421 1:33160033-33160055 CAGAGAGGAAAGGGTGGGAAAGG + Intronic
904953642 1:34264753-34264775 CAGTGGGGAGAGGGTGGGAATGG + Intergenic
905143811 1:35870738-35870760 CAGAGGGGAAAGAATGGGAATGG - Intronic
905401304 1:37705635-37705657 CTGAGGGTGAAGCGTGGGTGAGG - Intronic
905408775 1:37754166-37754188 CGGAGGGTGGGGGGTGGGAGTGG - Intronic
905461528 1:38125908-38125930 GAGAGGGTGGAGTGTGGGAGGGG + Intergenic
905779729 1:40697819-40697841 CACATGGAGAAGTGTGGGAAGGG - Intronic
905977603 1:42189442-42189464 GAAAGGGTGAAGTGTGGTAAGGG + Intronic
906117512 1:43366422-43366444 CAGGGGGTGGAGGGTGGGTCCGG + Intronic
906562028 1:46765477-46765499 AAGTGGGTGGAGGGTGGGGAAGG - Intronic
906634165 1:47397211-47397233 CTGAAGTTGAAGGGAGGGAAAGG - Intergenic
906754553 1:48297644-48297666 TAGAGAGTGAGGGGAGGGAAAGG - Exonic
906900006 1:49824653-49824675 CAGAGAAAGAAGGGTAGGAATGG + Intronic
906911790 1:49960012-49960034 TTGAGGGTGAAGGGTGGGAGCGG + Intronic
907265302 1:53255924-53255946 AAGAGGGTGGAGAGTGGGATGGG + Intronic
907303816 1:53503081-53503103 CAGAGAGGGAAGGGCGGGACAGG + Intergenic
907372070 1:54010210-54010232 CAGAGGGCAAAGGGTGAGCAGGG - Intronic
907487353 1:54787076-54787098 CTGGGGGTGAAGGGTGGGAGAGG + Intronic
907637745 1:56153158-56153180 CATGGGGTGAGGGTTGGGAAGGG + Intergenic
907726222 1:57023212-57023234 CAGAGGTGGAAGAGTGGAAATGG + Intronic
908049005 1:60207422-60207444 CAGAAGGTGAAGGGGGAGCAAGG + Intergenic
908082779 1:60598536-60598558 CGGGGGGAGAAGGGAGGGAAGGG + Intergenic
908082809 1:60598629-60598651 AAGGGGGAGAAGGGAGGGAAGGG + Intergenic
908257001 1:62311014-62311036 GAGTGGGTTAAGGGTGGGAGGGG + Intronic
908344268 1:63215576-63215598 CAGTGGGTGGGGGGTGGGTAGGG + Intergenic
908626761 1:66053552-66053574 CAGTGGGTGAATGTTAGGAATGG + Intronic
908862405 1:68504499-68504521 CTCAGGGGAAAGGGTGGGAAGGG + Intergenic
908940279 1:69424032-69424054 CAGAAGGTCAAGGAAGGGAAAGG - Intergenic
909093368 1:71255361-71255383 CAGAAAGTGAAGGGTGAGCAAGG - Intergenic
909269711 1:73607135-73607157 CAGAAGGTGAAGGGGAAGAAAGG + Intergenic
909270825 1:73621326-73621348 CAGAGGGTGAAGGGGGGAGGAGG + Intergenic
909524384 1:76606561-76606583 CAGAGGGTGGAGGGGGAGGAGGG + Intronic
909703152 1:78550774-78550796 TAGAAGGTGGAGGGTGGGATGGG + Intergenic
909710106 1:78639305-78639327 CTAAGGGTGAAAGTTGGGAAAGG + Intronic
909994724 1:82265433-82265455 TAGATGGTGTAGGGTTGGAAAGG + Intergenic
910439044 1:87233531-87233553 CATAGGGTGATGGGGAGGAAGGG - Intergenic
911086514 1:93982234-93982256 TAGAGGGGGCAGGGAGGGAAGGG - Intergenic
911103635 1:94113218-94113240 TAGAGGGTGTATGGTGGGGAGGG - Intronic
911168311 1:94744814-94744836 TAGAGTGTGAAGTGTGGGAGGGG + Intergenic
911457802 1:98148914-98148936 CAGAAGGGGAAAGGTGGGAGGGG + Intergenic
911634975 1:100225217-100225239 CAGAGTATGGAGGGTAGGAAGGG - Intronic
911715634 1:101129646-101129668 CTGAGGGGGAAGGGTGGGAGGGG - Intergenic
912154743 1:106904008-106904030 CAGAAGGTGAAGGGTAAGCAAGG + Intergenic
912474006 1:109924325-109924347 CAGAGGATGAGAGGTGGAAATGG + Intronic
912550952 1:110484979-110485001 CAGAGAGTGGCTGGTGGGAAAGG - Intergenic
912886868 1:113484390-113484412 TAAAGGGTGAGGGGTGGCAAGGG - Intronic
913565195 1:120066696-120066718 GAGAGGCAGTAGGGTGGGAATGG + Intronic
913576246 1:120178066-120178088 TAGAAGGCGGAGGGTGGGAAGGG - Intergenic
913632934 1:120726863-120726885 GAGAGGCAGTAGGGTGGGAATGG - Intergenic
913647228 1:120869928-120869950 AAGAGGGTGAAGGGATGGAAGGG - Intergenic
914079414 1:144392934-144392956 AAGAGGGTGAAGGGATGGAAGGG + Intergenic
914099765 1:144573568-144573590 AAGAGGGTGAAGGGATGGAAGGG - Intergenic
914174313 1:145261480-145261502 AAGAGGGTGAAGGGATGGAAGGG + Intergenic
914244673 1:145876761-145876783 CAGAGACTACAGGGTGGGAAAGG - Intronic
914285784 1:146226053-146226075 GAGAGGCAGTAGGGTGGGAATGG + Intronic
914299224 1:146364113-146364135 AAGAGGGTGAAGGGATGGAAGGG + Intergenic
914349793 1:146831250-146831272 CAGAGGGCCAGGGATGGGAAGGG - Intergenic
914528980 1:148502664-148502686 AAGAGGGTGAAGGGATGGAAGGG + Intergenic
914546816 1:148676805-148676827 GAGAGGCAGTAGGGTGGGAATGG + Intronic
914619748 1:149393863-149393885 GAGAGGCAGTAGGGTGGGAATGG - Intergenic
914637411 1:149564444-149564466 AAGAGGGTGAAGGGATGGAAGGG - Intergenic
915444465 1:155966904-155966926 GAGAGGGTGAAGGGAGGGCCGGG + Intronic
915554403 1:156653328-156653350 CGGAGGTTGAGGGGTGAGAAGGG - Intronic
915565407 1:156710189-156710211 TGCAGGGTGAAGGGTGGGAGTGG - Intergenic
916665923 1:166967418-166967440 CGGAGGGGGAAGGGAGGGAGGGG + Intronic
916961896 1:169896939-169896961 AAGGGGGTGAGGAGTGGGAATGG - Intergenic
917078677 1:171234418-171234440 CAGAGGGTGAAGGGGAAGCAAGG - Intergenic
917460304 1:175223469-175223491 CAACAGGTGAAGGGTGGGAAGGG + Intergenic
917512758 1:175681802-175681824 TAGAAGGAGAAAGGTGGGAATGG + Intronic
917695941 1:177524172-177524194 CAGAGTGGCAAGGTTGGGAAAGG + Intergenic
917832516 1:178908080-178908102 CAGAGTGGGGAGGGTGGGAGAGG - Intronic
917936973 1:179877897-179877919 TAGAGGGTGAAGGATGGAGAAGG - Intergenic
917956246 1:180101864-180101886 CATAGGGTGGAGTATGGGAAAGG + Intronic
918002432 1:180510078-180510100 CAGCAGGGGGAGGGTGGGAATGG - Intergenic
918042523 1:180921893-180921915 CAGAGGCTCAAGGAAGGGAAGGG - Intronic
918147725 1:181772271-181772293 CAGAGGGTTAGGGGTAGGATGGG - Intronic
918202412 1:182279800-182279822 CAGGGGGTGGAGAGTGGGAGAGG - Intergenic
918321585 1:183370099-183370121 CAGAAGCAGAAGGGTGGCAAAGG + Intronic
919083033 1:192889202-192889224 CAGAAGGAGAAGGATTGGAATGG + Intergenic
919190579 1:194212179-194212201 CTGAGGGTGGAAGGTGGGAGAGG + Intergenic
919578622 1:199342747-199342769 CAGAGGGTGAGAGGAGGGAGAGG + Intergenic
919638235 1:200024777-200024799 GAGAGGGGGAAGGGAGGGGAGGG + Intergenic
919776947 1:201200422-201200444 CATGGAGTGAGGGGTGGGAATGG - Intronic
919858461 1:201721677-201721699 CCGAGGCTGATGGGTGGGCAGGG - Intronic
920074414 1:203326028-203326050 AAGATGGGGAATGGTGGGAAGGG - Intergenic
920403466 1:205692079-205692101 CAGAGGGGGAAAGGTGTGGAGGG - Intergenic
920687962 1:208124215-208124237 TTGAGGGTGGAGGGAGGGAAGGG + Intronic
921076028 1:211700923-211700945 CAGAGGCTGAAGGGTGGGTGGGG - Intergenic
921262294 1:213395028-213395050 CAGGGGAAGGAGGGTGGGAAAGG - Intergenic
921440115 1:215175643-215175665 TAGAGTGGGAAGGGAGGGAAGGG - Intronic
921687950 1:218112238-218112260 CAGAGGTTCAATGTTGGGAAGGG + Intergenic
921909365 1:220529383-220529405 CAAAGCGAGAAGGATGGGAATGG + Intronic
921964660 1:221075718-221075740 TTGAGGGTGGAAGGTGGGAAAGG - Intergenic
922040846 1:221895099-221895121 TAGAGAGAGAAGGGAGGGAATGG + Intergenic
922071186 1:222195106-222195128 CAGAGTGTGAGGCGTGGGAAGGG - Intergenic
922898952 1:229121634-229121656 CAGGGCCTGAGGGGTGGGAACGG - Intergenic
923228415 1:231961007-231961029 CATAGGGTGAGGTATGGGAAAGG + Intronic
923249348 1:232165773-232165795 CAGAGTGGGGAGGGTGGGAGAGG + Intergenic
923392717 1:233529959-233529981 CTGTTGGTGAAGGGTTGGAATGG + Intergenic
923930658 1:238692197-238692219 TAGAGGGGGAAGGGAGGGAGGGG + Intergenic
923996809 1:239504905-239504927 CTTGGGGGGAAGGGTGGGAAGGG + Intronic
924606506 1:245540051-245540073 CAGAGTGTGAAGGCAGGGAAAGG - Intronic
924809297 1:247387239-247387261 GTGAGGGTGAAGGGAGGGGAGGG + Intergenic
924831574 1:247600994-247601016 TGGAGGGTGAAAGGAGGGAAAGG + Intergenic
1063745261 10:8872170-8872192 CAGAGGGTGGAGGGTGGAGGAGG - Intergenic
1064464021 10:15561910-15561932 CAGAAGGTGAAGGGGGAGCAAGG + Intronic
1064871844 10:19946396-19946418 CAGGGGGTCAGGGGAGGGAAAGG - Intronic
1065181570 10:23131352-23131374 CAGAGGGTGGAAGGAGGGAGAGG + Intergenic
1065691798 10:28341678-28341700 TTGAGGGTGAAGGGTGCGAGGGG - Intergenic
1066476696 10:35753840-35753862 TTGAGGGTGGAGGGTGGGAGAGG - Intergenic
1066554829 10:36600573-36600595 GAAAGGGAGAAGGGTGGGAGGGG - Intergenic
1066618392 10:37319715-37319737 CAGAAGGTGGAGGGTGGGGTGGG - Intronic
1066706331 10:38183044-38183066 CACAGGGAAAAGGGTGGGAAGGG - Intergenic
1067005531 10:42657341-42657363 AAAAGGGGGGAGGGTGGGAAGGG - Intergenic
1067249162 10:44572702-44572724 AAGAGAGAGAAGGGGGGGAAGGG - Intergenic
1067655495 10:48188514-48188536 CTGAGGGTAAAGGGTGGGTCAGG + Intronic
1069357274 10:67601272-67601294 CAGATGGTGGATGGGGGGAATGG + Intronic
1069627614 10:69877997-69878019 CACAGGGTGCAGGAAGGGAAAGG - Intronic
1069979090 10:72239830-72239852 CAGAGGCCCAAGGGTGGGAAAGG + Intergenic
1070049742 10:72876614-72876636 GAGAAGGTTAAGGGTGGGATGGG - Intronic
1070085586 10:73233983-73234005 TAGTGAATGAAGGGTGGGAAAGG - Intronic
1070276298 10:75010711-75010733 CCGATGGTGGAGGGTGGGAGAGG - Intronic
1070774817 10:79103434-79103456 GGGAGGGTGAACGGTGGAAATGG + Intronic
1070778228 10:79122679-79122701 CAGGGTGTGATGGGTGTGAAAGG - Intronic
1071022627 10:81076572-81076594 CTGAGGGTGGAGGGTGGGAGAGG - Intergenic
1071028738 10:81146387-81146409 CAGAAGGTGAAGGGTGAGGAAGG - Intergenic
1071299592 10:84246377-84246399 CAGAAGGGGAAGGGTGGGAGAGG - Intronic
1071643646 10:87341708-87341730 GACAGGGTGAAAGGTGAGAAAGG + Intergenic
1071727755 10:88217030-88217052 TAGGGGGTGAGGGGTGGGATGGG + Intergenic
1071911114 10:90234879-90234901 CAGGGGGAAAAGGGTGGGAAGGG + Intergenic
1072039232 10:91591434-91591456 CAGAGAGGGTAGGGTGGGGAGGG - Intergenic
1072105906 10:92273726-92273748 CAGAGGGTGAGGGTAAGGAAAGG + Intronic
1072158851 10:92747943-92747965 CAGAGGGAGAAGAGGGGGAAGGG - Intergenic
1072187373 10:93053170-93053192 CAGAGTGTGATGGGTAGAAAAGG - Intronic
1072196866 10:93123542-93123564 AAGAGGGTGGAGGCTGGGTACGG + Intergenic
1072660109 10:97358695-97358717 CAGAGGATGAAGGGAGGTTATGG - Intronic
1072744901 10:97933101-97933123 GAGAGTGGGAAGGGTGGCAATGG + Intronic
1073006819 10:100330806-100330828 GAGAGGGTGAAGTGAGGGAAGGG - Intergenic
1073091114 10:100940731-100940753 AAGATGGGGAAGGGAGGGAAGGG - Intronic
1073119486 10:101112910-101112932 CTGAGGGTGCAGGGTGAGAGTGG - Intronic
1073136700 10:101224375-101224397 GAGAGGGGGAAGGGAGGGGAGGG + Intergenic
1073265822 10:102227901-102227923 AAGAGGGTGAAGGCTGGGAGGGG - Intronic
1073327321 10:102650378-102650400 CAGGTGGTGGAGGGTGGGAATGG + Intronic
1073491174 10:103854673-103854695 CGGAGGGTGGAGGTTGGGCAAGG + Intronic
1073543659 10:104331770-104331792 CTGAGGGTGAAAGGAAGGAAAGG - Intronic
1073847305 10:107571829-107571851 CTCAGGGGTAAGGGTGGGAAGGG + Intergenic
1073877196 10:107938549-107938571 CTCAGGGAGAAGGGAGGGAAGGG - Intergenic
1073894920 10:108144334-108144356 CAGAGGGAGGAGGGGGGGGAAGG - Intergenic
1073989883 10:109250814-109250836 CAGAGGGTGGAAGGAGGGAGAGG - Intergenic
1074112061 10:110429736-110429758 CAGAGAAGGAAGGGAGGGAAGGG - Intergenic
1074239213 10:111620573-111620595 CAGAAGGTGAAGGGGAAGAAAGG - Intergenic
1074558637 10:114515292-114515314 GAGAGGGTCACGGGAGGGAATGG - Intronic
1075245136 10:120814881-120814903 CAGAGGGTGAAGGGGAAGCAAGG - Intergenic
1075941407 10:126393329-126393351 CAGAAGGGGAAGGATGGGAGGGG - Intergenic
1076178783 10:128389437-128389459 GCGAGGGTTAAGGGTGGGAAAGG + Intergenic
1076212947 10:128664943-128664965 CAGAGGCTGGGGGATGGGAATGG + Intergenic
1076542234 10:131221386-131221408 CAGTGGGAGGTGGGTGGGAAAGG + Intronic
1077006171 11:358293-358315 CAGAGAGCGCGGGGTGGGAAGGG + Intergenic
1077055915 11:593053-593075 CAGAGGGTGAAGGAGGAGCAGGG - Intronic
1077184293 11:1229408-1229430 CAGAGGGCCCAGGGTGGGAAGGG + Intronic
1077218600 11:1405391-1405413 CACAGGGGGAAGGCTGGGCAAGG - Intronic
1077440265 11:2565584-2565606 CTGAGGGTGCAGTGTGGGATGGG + Intronic
1077975797 11:7247249-7247271 CTCAGGGGAAAGGGTGGGAAGGG - Intronic
1078797252 11:14604707-14604729 CAGAGGAAGGAGGGAGGGAAGGG - Intronic
1079060496 11:17244619-17244641 CAAAGGAAGAAGGGTGGGGAGGG - Intronic
1079242231 11:18729152-18729174 CAGAGGGTAATGGTTGGCAAGGG - Intronic
1079478160 11:20853234-20853256 CAGAGAAGGAAGTGTGGGAAAGG + Intronic
1079819665 11:25109558-25109580 TAGAGGGTGAAGGGAGAGGAAGG - Intergenic
1079871239 11:25800872-25800894 CAGAGGGTGAAGGGGAAGCAAGG - Intergenic
1079880781 11:25923775-25923797 CAGAGGGGGAAGGGAGGGAGGGG - Intergenic
1079999322 11:27329497-27329519 TAGAGGGGGAAGGGAGGGAGAGG - Intergenic
1080084425 11:28260871-28260893 CATAGGCTGTAGGGTAGGAATGG + Intronic
1080249217 11:30214184-30214206 TTGAGGGTGGAGGGTGGGAGGGG - Intergenic
1080684834 11:34506333-34506355 CAGAGGGAGGAGGCAGGGAAGGG + Intronic
1080973013 11:37301840-37301862 CAGAGAGTGGCTGGTGGGAAAGG - Intergenic
1081509020 11:43749230-43749252 GAGAGGGTGAAGGGAAGAAAGGG + Intronic
1081846767 11:46246366-46246388 CTCAGGGGAAAGGGTGGGAAGGG - Intergenic
1081867941 11:46369895-46369917 CACTGGGTGAGGGGTGGGCAGGG - Intronic
1082939388 11:58687942-58687964 TAGAAAGAGAAGGGTGGGAATGG + Intronic
1083028949 11:59574577-59574599 CAGATGGTGAAGGAAGAGAAGGG + Exonic
1083050604 11:59772946-59772968 CAGGGGGTGAGGGGTGAGAAAGG - Intronic
1083252744 11:61478768-61478790 CACAGGGTGAAGGGAGAGAGGGG - Intronic
1083285585 11:61656608-61656630 CAGGGGGTGCAGGGTGGTGAGGG + Intergenic
1083547710 11:63561313-63561335 CTGAGGGAAAAGGGTGGGAGTGG + Intronic
1083608452 11:63993024-63993046 CAGAGGGTGAAGGGGAGGCAGGG + Intronic
1083619235 11:64040783-64040805 CAGAGGGAGAAGGGAGTGAAGGG + Intronic
1083676780 11:64330380-64330402 CAGGGGGTGGAGGGTGGGGTGGG + Intergenic
1083780746 11:64916166-64916188 CAGAGGCTTGAGGCTGGGAACGG - Intronic
1083869246 11:65477084-65477106 CAGAGGATGAAGGGCGAGAAGGG + Intergenic
1083896827 11:65624288-65624310 TAGAGGGAGACAGGTGGGAAGGG - Exonic
1083910399 11:65705292-65705314 CAGAGGGTGAAGGGGAAGCAAGG - Intergenic
1084426952 11:69089348-69089370 CAGAGGGTGCAGGGCCAGAACGG - Intronic
1084453875 11:69256244-69256266 CAGAAGGTGAAGGGGAGGCAAGG + Intergenic
1084611322 11:70204903-70204925 CAGAAGGTGAGCGGTGGGTATGG + Intronic
1084742773 11:71150112-71150134 GGGAGGGAGAAGGGAGGGAAGGG + Intronic
1084870954 11:72098246-72098268 CAGTGTGAGAAGGGTGGGCAGGG + Intronic
1084985595 11:72868350-72868372 CAGAGGGCGATGGGTGGGGAAGG + Intronic
1085531926 11:77197081-77197103 CAGACGGGGAAGAGAGGGAATGG - Intronic
1085625057 11:78065393-78065415 CAGAGGGTAGGAGGTGGGAAGGG + Intronic
1085781785 11:79415887-79415909 GAGAGGGTGAAGGGGTGGGAGGG - Intronic
1086148733 11:83584739-83584761 CTGATGGAGAAGGGTGAGAATGG + Intronic
1086265108 11:84988714-84988736 CAGTGGGGAAAGGATGGGAAGGG + Intronic
1086337180 11:85811313-85811335 CGGAGGGCGAAGGGAGGGAAGGG - Intergenic
1086390858 11:86361256-86361278 CACAGGTTGTAGGCTGGGAATGG + Intergenic
1086505709 11:87502090-87502112 CAGAGGGAGGAGTGGGGGAAGGG - Intergenic
1086587697 11:88474539-88474561 AAGGGGGTAAAGGGAGGGAAGGG + Intergenic
1086819513 11:91417840-91417862 CAGAGGCTGAGGTTTGGGAAAGG + Intergenic
1086845094 11:91739014-91739036 CAGAAGCAGGAGGGTGGGAAAGG + Intergenic
1087449407 11:98299413-98299435 AAAAGGGGGAAGAGTGGGAATGG - Intergenic
1087702456 11:101450806-101450828 GAGATGGTGAAGAGTGGGCAGGG + Intergenic
1088178251 11:107078914-107078936 GAGAGGGTGCAAGCTGGGAAGGG + Intergenic
1088188274 11:107197723-107197745 CAGAGGAGGAAGGGTAGGATGGG - Intergenic
1088674652 11:112180675-112180697 AAGTGGGTGGAGGGGGGGAAGGG + Intronic
1088846776 11:113674917-113674939 CAGCTGGTGAGGGGTAGGAACGG - Intergenic
1089177738 11:116560520-116560542 CAGAGGGGGAGGGGAGGGAGCGG + Intergenic
1089257412 11:117201096-117201118 CACAGGGTGAAGGGAGGGATTGG + Intronic
1089735894 11:120550099-120550121 CAGAGGGTCAGGAGTGGGAGTGG + Intronic
1089819922 11:121215560-121215582 GAAAGGGTGGAGGGTGGGATGGG + Intergenic
1090246024 11:125216531-125216553 AAGAGGGAAAGGGGTGGGAAGGG - Intronic
1090270100 11:125379998-125380020 TAGGGGGTGGAGGGTGGGATGGG + Intronic
1090419660 11:126565742-126565764 CAGGGAGTGAAGTGGGGGAAGGG + Intronic
1090498898 11:127242393-127242415 CACAGAGTCAAGGGAGGGAAAGG + Intergenic
1090595616 11:128318193-128318215 CTCAGGGAGAAGGGTGGGAAGGG - Intergenic
1090894521 11:130958738-130958760 CTCAGGGAAAAGGGTGGGAAGGG - Intergenic
1091111127 11:132969102-132969124 CTCAGGGGGAAGGGTGGGAGGGG - Intronic
1091329163 11:134717110-134717132 AAAAGGGTGCAGGGTGGGAGAGG - Intergenic
1091682077 12:2534274-2534296 CAGAGGGCGAATGCTGGAAAGGG + Intronic
1091785325 12:3239782-3239804 CTGATGGGGAAGGGTGGAAAAGG + Intronic
1091874654 12:3924025-3924047 TAGATGGAGAAGGGAGGGAAGGG + Intergenic
1092022567 12:5214592-5214614 CCGGGGCTGAAGGCTGGGAAAGG + Intergenic
1092158243 12:6299014-6299036 CTCAGGGGGAAGGGTGGGAGAGG + Intergenic
1092240079 12:6830773-6830795 CAGTTGGGGAAGGGTGGAAACGG + Intronic
1092253815 12:6915690-6915712 CAGTGGGTGGGGGGTGGGTAGGG - Exonic
1092385722 12:8034186-8034208 CCAAGGGTGAAGGGTGGTATGGG - Intronic
1092575487 12:9777968-9777990 TTGAGGGTGGAGTGTGGGAAGGG - Intergenic
1092603821 12:10097609-10097631 CTGAGGTTGAAGGGTGGAGAGGG - Intronic
1093770824 12:23015776-23015798 CTCAGGGGAAAGGGTGGGAAGGG - Intergenic
1093857109 12:24118087-24118109 TAGAGGCTGGGGGGTGGGAAGGG + Intergenic
1093971106 12:25376852-25376874 CAAAGAGGGAAGGGAGGGAAAGG + Intergenic
1093980188 12:25467373-25467395 AAGAGTGTGAAGGGGAGGAATGG + Intronic
1094047959 12:26187651-26187673 CAGAGGTAGAAGGAGGGGAATGG + Intronic
1094161012 12:27391185-27391207 TAGAGGGGGAAGGGAGGGAAGGG - Intronic
1094166167 12:27446261-27446283 CAGAGGGAGCAGGAGGGGAAGGG + Intergenic
1094446772 12:30539509-30539531 CTCAGGGTGAAGTGTGGGAGAGG - Intergenic
1095252779 12:39998377-39998399 TTGAGGGAAAAGGGTGGGAAGGG + Intronic
1095337543 12:41047113-41047135 GAGAGGGTGAATGTTGGGGATGG - Intronic
1095389191 12:41685610-41685632 GAAAGGGTGAAAGGTGGGTAAGG + Intergenic
1095542502 12:43327241-43327263 CAGAGGGTGAAAGGAAGGAGAGG - Intergenic
1096194015 12:49637391-49637413 CTGAGGGGGAAGAGAGGGAATGG - Exonic
1096199661 12:49672677-49672699 CTGGGGGTGCAGAGTGGGAAAGG - Intronic
1096344804 12:50836436-50836458 CTCAGGGGGAAGGGTGGGAGAGG + Intergenic
1096442694 12:51658669-51658691 TGGAGGCTGAAGGTTGGGAATGG + Intronic
1096621800 12:52869989-52870011 CAGAGGGTCAAATGTGGGAGGGG - Intergenic
1096995600 12:55836089-55836111 CAGAGGGGGAAGAGTTAGAATGG - Intronic
1097196068 12:57243073-57243095 GAGGGGGTGGAGGGTGGGTAAGG - Intergenic
1097708947 12:62897565-62897587 CAGAGGCTGAAGTGTGGACAAGG - Intronic
1098092858 12:66922728-66922750 CAGAGGGAGAAAAGGGGGAAGGG - Intergenic
1098300742 12:69051876-69051898 CAGTGGGAAAAGGGTGGAAAAGG + Intergenic
1098499276 12:71171652-71171674 CAGTGGGTGGAGGTTGGGAGTGG - Intronic
1098809621 12:75069701-75069723 CAGAGGTTGAAGGTGAGGAAGGG - Intronic
1098836237 12:75427836-75427858 CAGAGGGTGAAGGGGAAGCAAGG - Intronic
1099550340 12:84035762-84035784 CGGTGGGGGAAGGGTGGGAGTGG - Intergenic
1099562031 12:84191087-84191109 AGGATGGTGAAGGGTTGGAAGGG - Intergenic
1099964435 12:89430597-89430619 CAGAGGGTGGGTGGTGGAAAGGG - Intronic
1100552793 12:95662196-95662218 CAGAAGGAGAGGGGAGGGAAGGG - Intronic
1100774466 12:97959163-97959185 GAGAGAGTGAAGGGAGGGAAAGG + Intergenic
1101481743 12:105104769-105104791 CTGAGAGTGGAGGGTGGGAGTGG - Intergenic
1101591762 12:106131139-106131161 CTCAGGGTGGAGAGTGGGAAAGG - Intronic
1101812271 12:108117989-108118011 CAGAGGCTGAAGAGTGGGAGGGG - Intergenic
1102403997 12:112656565-112656587 AAAAGGGGGAAGAGTGGGAAGGG - Intronic
1102540505 12:113615885-113615907 TAAAGGGGAAAGGGTGGGAAGGG + Intergenic
1102591489 12:113959727-113959749 GAGAGGGTGGAGGCTAGGAAAGG - Intronic
1102745365 12:115244527-115244549 CAGATGGCGATGGTTGGGAAGGG + Intergenic
1102867920 12:116388939-116388961 GGGAGGGTGGAGGGTAGGAATGG - Intergenic
1103882206 12:124174830-124174852 CAGATGGTGCAGGCTGAGAAGGG + Intronic
1104017185 12:124969061-124969083 CAGAGGGTGGGGGCTGGAAACGG - Intronic
1104200078 12:126580122-126580144 CAGGGGGTGAAGGCAGGAAAGGG + Intergenic
1104307035 12:127618937-127618959 TGGAGGGTGGAGGGTGGGAGTGG + Intergenic
1104496816 12:129248703-129248725 CAGAGGGTGGAGGGTGGAGCGGG - Intronic
1105210251 13:18253164-18253186 CCGAGGGATCAGGGTGGGAAGGG + Intergenic
1105954524 13:25268297-25268319 CAGAGGGTCAGGGGTAGGTATGG - Intronic
1106320338 13:28631807-28631829 AAGAAGGGGAAGGGTGGAAATGG - Intergenic
1106320477 13:28632898-28632920 CAGAGGGTGAAGGGTGTATGGGG - Intergenic
1106652745 13:31709236-31709258 CAGATGGCAGAGGGTGGGAAGGG + Intergenic
1106841333 13:33687823-33687845 AGGAGGGTGCAGGATGGGAAAGG + Intergenic
1107220765 13:37976995-37977017 TAGAGGGGGAAAGGTGGGAGGGG + Intergenic
1107251799 13:38372621-38372643 CCCAGGGGAAAGGGTGGGAAGGG + Intergenic
1107459497 13:40587861-40587883 CAGAGGGTTGATGGTGGTAATGG + Intronic
1107774353 13:43822661-43822683 AGGAGGGAGAAGAGTGGGAAAGG - Intergenic
1108134898 13:47345432-47345454 CCCAGGGAGAAGGGTGGGAGAGG + Intergenic
1108229829 13:48325123-48325145 CAGAGGGTGGAGGGTGGGAGAGG - Intronic
1108573821 13:51774077-51774099 CAGGGGGTGAAGAGTGGAAGGGG - Intronic
1108702403 13:52954909-52954931 CAGAGGAATGAGGGTGGGAATGG + Intergenic
1108738998 13:53315152-53315174 CAGAAGAGGGAGGGTGGGAAGGG + Intergenic
1108794777 13:54017835-54017857 AAGGGAGGGAAGGGTGGGAAAGG + Intergenic
1109287927 13:60433924-60433946 CTGATGGTAAAGGGTGGTAATGG + Intronic
1109483624 13:62990262-62990284 GAGAGGGTGAAGTGGGGTAAGGG - Intergenic
1109535765 13:63717388-63717410 CAGAGGATGGAGGGAGGGAGAGG - Intergenic
1109540336 13:63768898-63768920 CAGAGGATGGAGGGAGGGAGAGG + Intergenic
1109759722 13:66812068-66812090 CTTAGGGGGAAGAGTGGGAAGGG - Intronic
1110544766 13:76744127-76744149 CTCAGGGGAAAGGGTGGGAAGGG + Intergenic
1110554667 13:76844974-76844996 CAGAGGCTGGAGGATGGGAATGG + Intergenic
1110834623 13:80069374-80069396 CAGGGGATGATGGGTGGAAAAGG + Intergenic
1111113267 13:83743159-83743181 CAGAGGGTGGAAGGAGGGAGAGG + Intergenic
1111161269 13:84398311-84398333 CAGAGGGTGGAGGTTGGGAGTGG + Intergenic
1111350150 13:87017819-87017841 TTGAGGGTGGAGGGTGGGAGAGG - Intergenic
1111478234 13:88783315-88783337 CAGTGGGTGAAGTGTGAGGAGGG - Intergenic
1111924417 13:94447259-94447281 CAGGGGGTGGTGGATGGGAAGGG + Intronic
1111956692 13:94766703-94766725 CAGAAGGTGAAGGGGGAGAGAGG + Intergenic
1112314368 13:98348403-98348425 TAGAGTCTGAAGGCTGGGAAAGG + Intronic
1112377876 13:98860672-98860694 GTGAGGGTGGAGGGTGGGATGGG + Intronic
1112709729 13:102113725-102113747 CTGAGGGTAAAGGGGTGGAAGGG - Intronic
1112900554 13:104352497-104352519 AAGAGAGTGGAGGGGGGGAAGGG - Intergenic
1113205080 13:107907667-107907689 CAGAAGGTGAAGGGGGAGCAGGG - Intergenic
1113499145 13:110759621-110759643 CAGAGGCTGAAGGACTGGAAGGG + Intergenic
1114033132 14:18593835-18593857 GAGAGGGAGAAAGGTGGGGAGGG - Intergenic
1114424548 14:22611223-22611245 CAGATGGTGGAGGATGTGAAGGG + Exonic
1114673500 14:24427246-24427268 CACAGGCAGAAGGGTGGGAAGGG - Exonic
1115764910 14:36613714-36613736 TGGAGGGTGATGGGTGAGAAAGG + Intergenic
1115768802 14:36648883-36648905 CAGTGGGCGGCGGGTGGGAAAGG - Intergenic
1115787529 14:36842907-36842929 GATGGGGTGGAGGGTGGGAAGGG + Intronic
1116734109 14:48667274-48667296 GGGAGGGGGAAGGGGGGGAATGG - Intergenic
1116796776 14:49399638-49399660 CGGAGGGTGGAGGGAGGGTAAGG + Intergenic
1116995120 14:51315385-51315407 AAGAGGGTGAACGATGTGAAAGG - Intergenic
1117184817 14:53229101-53229123 CAGAAGATGAATGGTGGTAATGG - Intergenic
1117192714 14:53308937-53308959 CTCAGGGTGAAGCGTGGGAGGGG - Intergenic
1117328185 14:54687910-54687932 CAGAGGGTGATGCCTGAGAAGGG - Intronic
1117616203 14:57536191-57536213 CAGAGAGTGAAGAGAGGGGAAGG - Intergenic
1117829762 14:59738998-59739020 CAGACGGTGAAGGGGGAGGAAGG + Intronic
1118409129 14:65458371-65458393 AAGAGGGTAAAGGTTGGGCATGG + Intronic
1119131793 14:72179645-72179667 CAGGGGGTGGGGGGTGGGGAAGG - Intronic
1119157402 14:72423668-72423690 TAGAGGGGGTAGGGTGGGAGGGG + Intronic
1119434739 14:74590839-74590861 CAGAAGGGAAAGAGTGGGAAGGG + Intronic
1119519627 14:75276711-75276733 AAGAGGGGGACGGGAGGGAAAGG - Intergenic
1119804942 14:77476375-77476397 CACATGCTGAATGGTGGGAAAGG + Intronic
1119853030 14:77879541-77879563 CAGAGGGAGGAGGGTGGGGCAGG + Intronic
1119890571 14:78179181-78179203 CACAGGATAAAGGGTGGGAAGGG + Intergenic
1120153230 14:81061642-81061664 CAGAGGGTGGGAGGAGGGAAAGG + Intronic
1120281139 14:82439343-82439365 CAGAAGGTGAAGGGGAAGAAAGG - Intergenic
1120337665 14:83178921-83178943 CAGAGAGTGAAGGGCAGGATGGG + Intergenic
1121081943 14:91115331-91115353 AAGGAGGTGATGGGTGGGAAGGG + Intronic
1121324656 14:93012946-93012968 GTGTGGGTGCAGGGTGGGAAGGG - Intronic
1121629376 14:95411480-95411502 CAGAGAGTGGGGAGTGGGAAAGG + Intronic
1122171575 14:99880385-99880407 CAGAGGAAGAAAGGCGGGAAGGG - Intronic
1122237650 14:100341283-100341305 CACAGGGTGCAGAGTGGGGAGGG - Intronic
1122259581 14:100506061-100506083 TAGAGGGTGGAGGGAGGGAGCGG - Intronic
1122498099 14:102173620-102173642 CGCAGGGGGAAGGGTGGGAGGGG - Intronic
1122707892 14:103632869-103632891 CAGGGGGTCAGGGGTGGGATTGG + Intronic
1122830067 14:104391523-104391545 CAGAGGGGCAAGGTTGGGGAGGG + Intergenic
1122880955 14:104690217-104690239 CAGCGGTTGCGGGGTGGGAAGGG - Intronic
1123018574 14:105387025-105387047 CAGGAGGTGCAGGGTGGGAGTGG - Intronic
1124044624 15:26137541-26137563 CAGTGGATGATGGGAGGGAAAGG - Intergenic
1124113123 15:26811498-26811520 CTGAAGGTGGAGGGTGGGAGGGG + Intronic
1124572682 15:30880220-30880242 GAGAGGGTGAAGGGTATGTAGGG - Intergenic
1125378304 15:39058111-39058133 CTCAGGGGGAAGGGTGGGAGAGG + Intergenic
1125449333 15:39791651-39791673 CGGAGGGTGGAGGGTGGGAGAGG + Intergenic
1125501962 15:40245500-40245522 CAGAGGGTGGAGGGAGCGAGGGG + Intronic
1125734173 15:41912026-41912048 CAGTGGGTGAAGGGTGTGGCAGG - Intronic
1126053861 15:44711647-44711669 CAGAGGGTGCAGAGCGGGAGAGG - Intronic
1126405467 15:48318293-48318315 CAGAGGGAGAAGGGCGGGAAAGG - Intergenic
1127109537 15:55652666-55652688 CTAAGGGGGATGGGTGGGAAAGG + Intronic
1127533215 15:59865238-59865260 CAGAGGGTCCAGGGAGGGCATGG + Intergenic
1127823347 15:62680727-62680749 CAGAAGGGAAAGGGTGGGAGTGG - Intronic
1127942742 15:63716327-63716349 CAGAGGATGAAGAGGAGGAACGG - Exonic
1128717220 15:69917485-69917507 CCCAGGGTGAAGGGTAGGACAGG + Intergenic
1128930714 15:71702809-71702831 GAAAGGGAGAATGGTGGGAAGGG - Intronic
1129604097 15:77016377-77016399 CAGAGGCTGAGGGGTGGGAAGGG + Intronic
1129643524 15:77408383-77408405 CACAGGGGGAAGGGTGGGAGGGG + Intronic
1129923941 15:79345294-79345316 CAGAGGGTGAAGGGTGGGAAGGG - Intronic
1130053031 15:80499616-80499638 AAGAGGGGGAAAGGTGGCAAAGG + Intronic
1130133803 15:81164902-81164924 CACAGGATGGAGGGTGGGATGGG + Intronic
1130181630 15:81635202-81635224 CTTAAGGGGAAGGGTGGGAAAGG - Intergenic
1130819490 15:87479398-87479420 CAGAGGATGAAGGTAAGGAATGG + Intergenic
1131458083 15:92598794-92598816 GAGAGAGTAAAGGGTGGGATGGG - Intergenic
1132389181 15:101426349-101426371 CAGACAGTGAGTGGTGGGAATGG + Intronic
1132529075 16:435610-435632 GAGAGGGCGTATGGTGGGAAGGG + Intronic
1132683929 16:1154396-1154418 CAGACAGTGAGGGGTGGGCAAGG - Intronic
1132803510 16:1765421-1765443 TAGAGGGTGACGGGTGGGCACGG + Intronic
1132833481 16:1941180-1941202 CAGAGGGAGGAAGGTGGGACTGG + Intronic
1132848756 16:2014090-2014112 CAGGGTGTGAAGGGTGGGCAGGG + Intronic
1132862017 16:2076449-2076471 CAGACAGTGAGGGGTGGCAATGG - Intronic
1132873515 16:2125826-2125848 CAGGCTGTGAAGGGTGGGAGTGG - Intronic
1133039716 16:3053988-3054010 CATGGGGTGAGGGGAGGGAATGG + Intronic
1133197312 16:4180325-4180347 CAGAGGGAGAAGGTGGGGACAGG + Intergenic
1133428777 16:5717500-5717522 CTAAGGGTGAAGGGTGGGAGGGG - Intergenic
1133696253 16:8265828-8265850 AGAAGGGGGAAGGGTGGGAAGGG - Intergenic
1134054375 16:11160303-11160325 GAGAGACTAAAGGGTGGGAAGGG - Intronic
1134187595 16:12096919-12096941 CAGAGGGTCACAGGAGGGAAAGG + Intronic
1134268844 16:12715986-12716008 TAGAGGGAGAAGGGTTGGCAAGG + Intronic
1134288617 16:12884245-12884267 AAGGGTGGGAAGGGTGGGAAGGG + Intergenic
1134552603 16:15145004-15145026 CAGGCTGTGAAGGGTGGGAGTGG - Intergenic
1134866158 16:17608938-17608960 CAGAGGGTGGAAGGTGGGATTGG + Intergenic
1135166218 16:20141386-20141408 CAGAGGGTGAAAGATGGGCAGGG + Intergenic
1135628168 16:24014263-24014285 CAGGGGGAGAGGGGTGGGGAGGG + Intronic
1135973018 16:27086014-27086036 CAGAAGGTGGAGGGTGGGAGGGG + Intergenic
1135973725 16:27091122-27091144 CAGGGGGGAAACGGTGGGAAGGG + Intergenic
1136135677 16:28255572-28255594 AAGAGGGTCAGGGGTGGGAGAGG + Intergenic
1136257900 16:29054628-29054650 CAGAGGGTACAGTGTGGGCAAGG - Intergenic
1136455286 16:30376718-30376740 GAGTGGGGGAAGGGTCGGAAGGG - Intronic
1137000186 16:35222297-35222319 AAAGGGGTGAAGGGTGGGAGTGG - Intergenic
1137019964 16:35415014-35415036 AAAGGGGTGAAGGGTGGGAGCGG - Intergenic
1137027007 16:35486509-35486531 AAGAGGGGAAAGGGTGGGAGTGG - Intergenic
1137321778 16:47391131-47391153 CAGAGGCACAAAGGTGGGAAAGG + Intronic
1137817240 16:51410133-51410155 CAGTGGGTGAGGGGTCTGAAGGG - Intergenic
1138027554 16:53534363-53534385 CTGAGGGTGAGCTGTGGGAAGGG + Intergenic
1138113601 16:54343021-54343043 GAGAGGGGGAATGGTGGGTAAGG - Intergenic
1138354985 16:56370425-56370447 CAGGGGCTGAAGGTTGGGGAAGG + Intronic
1138527844 16:57619378-57619400 CAAGGAGTGAAGGGTGGGACAGG + Intronic
1138605829 16:58088220-58088242 GGGAGGGGGAAGGGTGGGAGTGG + Intergenic
1139065919 16:63314429-63314451 CAGAAGATAGAGGGTGGGAAAGG + Intergenic
1139071059 16:63383264-63383286 GAGATGGTGAAAGGTGGTAAAGG - Intergenic
1139165955 16:64565671-64565693 CAGAAGGTGAAGGGGAAGAAAGG - Intergenic
1139202937 16:64997496-64997518 CTGAGTGTCAAGGGTGGGGATGG - Intronic
1139320443 16:66109794-66109816 CAGAAGGGGAAGGGAGGGAAGGG + Intergenic
1139505950 16:67398186-67398208 TAGAGGATGAAGGGTGGGAGGGG - Intronic
1139550440 16:67669852-67669874 CACAGAGTGAAGGGAGGAAAAGG - Intergenic
1139586200 16:67905418-67905440 CAGATGAGGAAAGGTGGGAATGG - Intronic
1139696794 16:68680816-68680838 CAGTGGGTGAGGGGTGGTCAAGG + Intronic
1139984243 16:70884281-70884303 CAGAGGGCCAGGGATGGGAAGGG + Intronic
1140123851 16:72104693-72104715 TGGAGGGTGGAGGGTGGGTAGGG + Intronic
1140136566 16:72211002-72211024 CAGTTGGTGAAGGGTGGCAAGGG + Intergenic
1140842016 16:78848590-78848612 AACAGGGTGCAGAGTGGGAAGGG + Intronic
1141193619 16:81842862-81842884 CAGAAGGTGATGGGTAGGCAGGG + Intronic
1141389938 16:83656084-83656106 CTGGGTGTGAGGGGTGGGAATGG - Intronic
1141537751 16:84694658-84694680 TAGAGGGGGAAGGGAGGGAGGGG + Intergenic
1141550513 16:84803701-84803723 CGGAGGGTGGAGGGTGGGAGCGG + Intergenic
1141850961 16:86645698-86645720 CAGAGGGGGACAGGTGGGCAGGG - Intergenic
1142022847 16:87794946-87794968 CAAAGGGTTCAGGCTGGGAAGGG - Intergenic
1142765672 17:2062918-2062940 GAGAGTGTGAAGGGAGGCAAGGG + Intronic
1142765840 17:2063788-2063810 GAGAGTGTGAAGGGAGGCAAGGG + Intronic
1143200723 17:5111545-5111567 TAGGGAGTGAAGGGTGGGAAGGG - Intronic
1143585222 17:7847464-7847486 CTGAGGGTGGAGGGGGGGATGGG + Intronic
1143631727 17:8143735-8143757 CAGGGGGTGGAGGGTGGCACGGG + Exonic
1143758336 17:9083037-9083059 CGGAGAATGAGGGGTGGGAAGGG - Intronic
1143823728 17:9587014-9587036 TTGAGGGTGGAGGGTGGGAGAGG - Intronic
1143864588 17:9914693-9914715 CAGAGGGTTAAGTGTGGAGAGGG + Exonic
1143910642 17:10245934-10245956 TGGAGGGTGAAGGGAGGGAGGGG + Intergenic
1143947458 17:10605614-10605636 CAGAGGGTGCAGGCCGAGAAAGG - Intergenic
1143990245 17:10953037-10953059 TAAAGGGGGAAGGCTGGGAACGG - Intergenic
1144018625 17:11220725-11220747 AAGAGGGAGAAGGGAGGGAAGGG - Intergenic
1144071198 17:11672631-11672653 GAAAGTGGGAAGGGTGGGAAGGG - Intronic
1144185320 17:12790453-12790475 GAAAGGGTGAGGGGTGGGAGAGG + Intronic
1144670991 17:17132500-17132522 GAGAGGGAGCAGGGTGGGGATGG + Intronic
1144741267 17:17583749-17583771 CAGAGAGTGAATGGTGAGAGAGG - Intronic
1145279006 17:21455019-21455041 GAGAGGGAGAGGGGAGGGAAGGG - Intergenic
1145950450 17:28812731-28812753 CAGAGGGAGAAGGGGTGCAAAGG - Intronic
1145998474 17:29117768-29117790 CAGAGGCTGAGGGATGAGAAGGG - Intronic
1146514025 17:33474767-33474789 CAGAGGGTGGAGAGTGGGTTTGG + Intronic
1146601589 17:34221758-34221780 CAGGGTGAGAAGGCTGGGAATGG + Intergenic
1146636925 17:34513421-34513443 CAGCTGGGAAAGGGTGGGAATGG - Intergenic
1146741405 17:35287055-35287077 CAGGGAGGAAAGGGTGGGAAGGG - Intergenic
1146806017 17:35865465-35865487 GAGGGGGTAAAGGGAGGGAAGGG + Intronic
1146824884 17:36013551-36013573 CAGGGGGAAAAGGGTGGGGAAGG - Intronic
1146933513 17:36794893-36794915 AAGAGGGAGATGTGTGGGAAGGG + Intergenic
1147182211 17:38693567-38693589 CGGTGGGTGTGGGGTGGGAAGGG + Intergenic
1147263412 17:39221841-39221863 CAGAGAGTTTAGGGTGAGAAGGG + Intronic
1147335624 17:39725494-39725516 CAGCATGTGAAGGGAGGGAAGGG + Intronic
1147365296 17:39954994-39955016 CAGAGGGTAAAGGAGAGGAAAGG - Intergenic
1147686951 17:42291878-42291900 CAGAGGCTGAAGGAGAGGAAGGG + Intronic
1147765706 17:42834105-42834127 CACAGGAGGAAGGGAGGGAAGGG + Intronic
1147862320 17:43530814-43530836 CAGTGGGGGGAGGGCGGGAAGGG - Intronic
1147986055 17:44308486-44308508 CAGAGGGTGCAGGGTCTGAGGGG - Intronic
1148141757 17:45333970-45333992 CAGTGGGTGGAGGGAGGAAATGG - Intergenic
1148152621 17:45405404-45405426 CAGAGGGTGAGGGGTGGGGCAGG - Intronic
1148155773 17:45424660-45424682 GAGTGGGGGAAGGGTGGGAGGGG + Intronic
1148200462 17:45746758-45746780 CCCAGGGTGAGGGGTAGGAAAGG - Intergenic
1148551107 17:48551188-48551210 CCGAGGGGGAGGGGTGGGAAGGG + Intronic
1148641857 17:49193666-49193688 GAGAGGGTGAGGGGGGGGAGGGG + Intergenic
1148684853 17:49495591-49495613 CTGAGGGTGGGTGGTGGGAAAGG + Intronic
1149637220 17:58180749-58180771 CACAGGGTGCAGGGAGGGAAGGG - Intergenic
1150387463 17:64773327-64773349 GAGTGGGGGAAGGGTGGGAGGGG + Intergenic
1151225678 17:72646542-72646564 CAGAGGGCTCAGGATGGGAAAGG - Exonic
1151750177 17:76032708-76032730 CAGTGGGCGAAGGGAGTGAAGGG - Intergenic
1151784435 17:76268481-76268503 CAGAGGGTGGGGGGGGGGCAGGG + Intronic
1151953021 17:77365693-77365715 AAGAGGGTGGAGGTTGGGAGTGG - Intronic
1152256959 17:79245523-79245545 GAGGGGGTGAGCGGTGGGAATGG - Intronic
1152258271 17:79252884-79252906 TAGAGGGGGAAGGGTGGGGTTGG - Intronic
1152283913 17:79401545-79401567 CAGAGGGAGAGGGGAGGGAATGG + Intronic
1152405661 17:80096567-80096589 CAGGAGGTGAGGGGTGGGCATGG - Intronic
1152523403 17:80873485-80873507 CGGAAGGTGGAGGGTGGAAATGG + Intronic
1153283366 18:3434867-3434889 CAGAGGTCAAAGGGTGTGAAAGG - Intronic
1153326835 18:3829451-3829473 GAGGGGGTGGAGGGTGGGGAAGG + Intronic
1153338418 18:3948763-3948785 CTCAGGGGAAAGGGTGGGAAGGG + Intronic
1153539277 18:6136438-6136460 CAGGGGGTGAGGGGTGCAAAGGG - Intronic
1153543800 18:6185566-6185588 GAGAGGGTGAGGGGTGGGACTGG - Intronic
1153817868 18:8806755-8806777 CAGTGGGTGCAGGGTGGGTGGGG - Intronic
1153842458 18:9019110-9019132 CAGAGGGTGGAAGGAGGGAAAGG - Intergenic
1154281578 18:13007889-13007911 CAGAAAGAGAGGGGTGGGAACGG - Intronic
1155060079 18:22220602-22220624 TTGAGGGTGGAGGGTGGGAGGGG - Intergenic
1155068486 18:22290113-22290135 CACAGGGTGGAAGGTGGAAAGGG + Intergenic
1155071475 18:22320705-22320727 CAAAGGGTGAAGGGAGAGAGAGG + Intergenic
1155178743 18:23324731-23324753 CAGGGGAGGAAGAGTGGGAAGGG + Intronic
1155403667 18:25465015-25465037 TAGATGGTTAAGTGTGGGAAGGG + Intergenic
1155451090 18:25963647-25963669 CAGTGGGTTTGGGGTGGGAATGG - Intergenic
1155771338 18:29704333-29704355 CAGAAGGGGGAGGGTGGGAAGGG - Intergenic
1155787153 18:29915204-29915226 CAAAGGATGGAGGGTGGGATGGG - Intergenic
1156164285 18:34399336-34399358 CTCAGGGGAAAGGGTGGGAAAGG + Intergenic
1156310706 18:35919228-35919250 AAGAGGGTGAAGGGTGCCAGTGG + Intergenic
1156386417 18:36609274-36609296 CAGAGGCTGCAGGGTGGAACTGG + Intronic
1156450879 18:37265996-37266018 CAGAGGAGGAGAGGTGGGAAGGG - Intronic
1156922003 18:42533395-42533417 GAGAGGCTGAAGGGAGGAAATGG + Intergenic
1157186077 18:45540957-45540979 AAGAGGGTGATGAGAGGGAAGGG + Intronic
1157471079 18:47989460-47989482 AAGAGGGTGAAGGAGGGGAGGGG + Intergenic
1157471440 18:47991971-47991993 CAGAGGATGGAGGCTGGGACTGG - Intergenic
1157474404 18:48012123-48012145 CAGATGGAGCAGAGTGGGAAGGG + Intergenic
1157501074 18:48191136-48191158 CAGAGGTGGGAGGGTAGGAACGG + Intronic
1157700674 18:49760001-49760023 CAGAGAGTGAAGGGTGAGGTGGG + Intergenic
1158126923 18:54110414-54110436 TTGAGGGTGAAGGGTGGGAGGGG - Intergenic
1158266895 18:55669236-55669258 CAGAGGCTGATGGGAGAGAATGG + Intergenic
1158549694 18:58424833-58424855 AAGATGGTGAAGTGTGAGAAAGG + Intergenic
1159254023 18:65922068-65922090 CAGAAGGAGGAGGGAGGGAAGGG - Intergenic
1159475834 18:68920109-68920131 CGAAGGGTGGAGGGTGGGAGAGG - Intronic
1159568240 18:70081167-70081189 TTGAGGGAAAAGGGTGGGAAGGG + Intronic
1160262095 18:77303642-77303664 CACAGGACCAAGGGTGGGAAGGG + Intergenic
1160327711 18:77966368-77966390 CAGAGGGGGTGGGGTGGAAAGGG + Intergenic
1160331892 18:78001272-78001294 CAGAAGGGGAAGGGTGAAAAGGG - Intergenic
1160686491 19:439170-439192 CAGAGAGGGAGGGGTGGGAGAGG + Intronic
1160808141 19:1001422-1001444 CAGGGGTTGGGGGGTGGGAATGG - Intronic
1160918934 19:1510803-1510825 CAGGGGGTGGCGAGTGGGAATGG - Intronic
1160983288 19:1826498-1826520 GAGAGGGGGAAGGGAGGAAAGGG + Intronic
1161139595 19:2639709-2639731 GAGGGGGGGAAGGGAGGGAAGGG + Intronic
1161619213 19:5289585-5289607 CAGAGGGAGGAGGGGGAGAAAGG - Intronic
1161646909 19:5458699-5458721 GAGAGGGAGGAGCGTGGGAAGGG + Intergenic
1161742049 19:6027390-6027412 CTGAGGCTGATGGGTGGGAGAGG - Intronic
1161990527 19:7681682-7681704 AAGGGGGTGGAGGGTGGGAGTGG - Intronic
1162017368 19:7852902-7852924 CTGAGCGTGAGGGGAGGGAATGG - Intronic
1162052588 19:8043695-8043717 CAGAGGGTGAGGTGAGGGCAGGG - Intronic
1162909533 19:13841790-13841812 CAGCTGGGGAAGGTTGGGAAGGG + Intergenic
1162941580 19:14013374-14013396 CAGTGGGGGAAGGGTGGGAAGGG + Intergenic
1163084982 19:14972976-14972998 CAGATGGCGAAGGCTGCGAAGGG + Intronic
1163213057 19:15856080-15856102 TTGGGGGTAAAGGGTGGGAAGGG + Intergenic
1163558844 19:18007383-18007405 CAGAGGCTGAAAATTGGGAAGGG + Intronic
1163695384 19:18761038-18761060 CAGAGGGTGGAGGGTGGGCCAGG - Intronic
1164287725 19:23836144-23836166 CATGGGGAGAAGAGTGGGAAGGG - Intergenic
1164471788 19:28542237-28542259 CAGAAGGGGGAGGGTGGGAGAGG + Intergenic
1164593472 19:29518948-29518970 CAGTGGGTGAATGGGGGGATTGG - Intergenic
1164649483 19:29881694-29881716 CAGTGGGTGAGGGATGGGCAGGG + Intergenic
1164971100 19:32533214-32533236 GAGAGGATGGAGGCTGGGAAGGG + Intergenic
1165140199 19:33694931-33694953 CAGAAGGGGAAGGGAGGGGAGGG - Intronic
1165611986 19:37162832-37162854 TGGAGGGTGAAAGGAGGGAAAGG + Intronic
1165817267 19:38649772-38649794 TGGAGGGGAAAGGGTGGGAAGGG + Intronic
1165893883 19:39130212-39130234 CAGAGGGATCAGGGTGGGACTGG + Intronic
1166104182 19:40589470-40589492 CGGAGGGGGAGGGGTGGGATGGG + Intronic
1166137788 19:40787648-40787670 CAGAGGGATCAGGGTGGGATAGG + Intronic
1166294120 19:41880737-41880759 AAGTGAGTGAAGGGTGGGGATGG + Exonic
1166721939 19:45001847-45001869 CAGAGGGTGATGAGGGGGTACGG + Intronic
1166920272 19:46224450-46224472 CAGAGGGTGAAGGGAAGGCAAGG - Intergenic
1167062446 19:47158075-47158097 CAGAGAGTGCAGGGTGGGGGTGG + Intronic
1167240186 19:48338883-48338905 CTGAGGGTGAGGGGTGAGCAGGG + Intronic
1167565220 19:50251985-50252007 GGATGGGTGAAGGGTGGGAAGGG + Intronic
1167622850 19:50568594-50568616 GAGAGGGAGACGGGAGGGAAGGG + Intergenic
1167665985 19:50823061-50823083 CTGGGGGTGCTGGGTGGGAAGGG + Intronic
1167780434 19:51595354-51595376 TAGAGGGTGGAGTGTGGCAAGGG - Intergenic
1167792780 19:51691459-51691481 AAGAGGGGGAAGGGGGAGAAGGG + Intergenic
1168371605 19:55839123-55839145 CCGTGGGTGAGGGGTGGGAAAGG - Intronic
925296583 2:2781149-2781171 CAGAGTGTGAAGGTGGGGGAGGG - Intergenic
925385209 2:3457285-3457307 CAGTGGGGGGAGGGTGGGATGGG + Intronic
925531419 2:4867339-4867361 GAGAGGGTGTAGGGCGGCAAGGG + Intergenic
925961719 2:9023397-9023419 CTCAGGGAGAAGGGTGGGAGGGG + Intergenic
926119896 2:10236209-10236231 AAGAGGGAAGAGGGTGGGAAGGG - Intergenic
926231962 2:11011109-11011131 CGGAGGGTGGAGGGTGAGGAGGG + Intergenic
926477735 2:13348483-13348505 CAGAGGGTGGAGGGTGAGGAGGG - Intergenic
926487985 2:13486674-13486696 CAGAAGGTGAAGGGTAAGTATGG - Intergenic
926560672 2:14414007-14414029 CTTGGGGGGAAGGGTGGGAAGGG + Intergenic
927049805 2:19316184-19316206 CAGAGGGAGGAGGGTGAGAGGGG - Intergenic
927799312 2:26083395-26083417 CTGAGGGGGAAGGGAGGGGAGGG - Intronic
928019391 2:27690300-27690322 CAGAGGGAGGAGGCTGGGAAGGG - Intronic
928204280 2:29273043-29273065 CAGAGGGGGAAGGAAAGGAAAGG - Intronic
928321965 2:30291014-30291036 CAGAGGGAGAAAGGATGGAAGGG + Intronic
928359678 2:30653062-30653084 CTGAGGGTGAAGGGTGCTATTGG - Intergenic
929085622 2:38164738-38164760 CAGAGGGTGAGGGGCTGGAGAGG - Intergenic
929382848 2:41372873-41372895 CAGAGGGTGAGAGGAGGGAGAGG + Intergenic
929596809 2:43181167-43181189 CAGAGAGTGAAGGGTGCGATGGG + Intergenic
929607630 2:43245588-43245610 CAGAGGGTTGAGGGTGGGAGTGG - Intronic
929641907 2:43589675-43589697 CTCAGGGGAAAGGGTGGGAAGGG + Intronic
929777838 2:44939494-44939516 TATAGGCTGAAGGGTGGGAGGGG - Intergenic
929875396 2:45792497-45792519 TAGAAGGGAAAGGGTGGGAAGGG - Intronic
930154912 2:48096681-48096703 CAGAGGGTGAAGGGTGGAAGAGG - Intergenic
930171104 2:48252576-48252598 CAGAGGACAAAAGGTGGGAAGGG + Intergenic
930299025 2:49592418-49592440 CAGAGGGGGAAGAGTAGGAGGGG + Intergenic
930474564 2:51864848-51864870 AAAAGGGTGAGTGGTGGGAAAGG - Intergenic
930513723 2:52380090-52380112 CAGTGGGAGAAGGGTTGCAAGGG + Intergenic
930935929 2:56951423-56951445 CAGATGGTGAAGGTGGGGGATGG + Intergenic
931088861 2:58864448-58864470 CAGAGGCAGATGGGAGGGAAAGG + Intergenic
931254140 2:60555381-60555403 CGGAGGGTGCAGGGTGGAGACGG + Intergenic
931331052 2:61283911-61283933 CAGAGGCTGGAGGGTGGGGTAGG + Intronic
932074895 2:68653648-68653670 CAGAGGGTGGAAGTTGGGGAAGG - Intronic
932090695 2:68803749-68803771 CAGAGGAGAAAGGATGGGAAAGG + Intronic
932237940 2:70136046-70136068 CAGGGGGTGGAGGCTGGGCAGGG - Intergenic
932337987 2:70941939-70941961 GAGAGGGTGGAAGGTGGGGAAGG + Exonic
932591066 2:73068070-73068092 AAGAGGGTGGAGGGTGTGGAGGG - Intronic
932716966 2:74107981-74108003 CTGAGGGAGAAGGGAGGGTAAGG - Exonic
933097745 2:78209118-78209140 CAAAGGGAGAAGAGTTGGAAGGG + Intergenic
933367598 2:81373616-81373638 AAGAGGGTGAAGAATGAGAATGG + Intergenic
933737205 2:85504708-85504730 CAGATGGTGGGGGGTGGGGAGGG - Intergenic
933774217 2:85762006-85762028 CAGAGGGTGGAGGGTAGGGCAGG + Intronic
934537562 2:95148268-95148290 CAGAGGATGGAGGCTGAGAAAGG - Exonic
934619148 2:95793554-95793576 AACAGGGTGAGGGGTGGGAATGG + Intergenic
934641743 2:96031003-96031025 AACAGGGTGAGGGGTGGGAATGG - Intronic
934675103 2:96244230-96244252 CTCAGGGTAAAGGGTGGGAAGGG + Intergenic
934711972 2:96522354-96522376 CAGAAGCTGGAGGGTGGGAGCGG - Intergenic
934793009 2:97078907-97078929 CAGAGGATGGAGGGTGAGGAGGG - Intergenic
934813178 2:97301578-97301600 CAGAGGATGGAGGGTGAGGAGGG + Intergenic
934824517 2:97406902-97406924 CAGAGGATGGAGGGTGAGGAGGG - Intergenic
934925668 2:98380343-98380365 CAGAGGGAGAAGGTAAGGAACGG + Exonic
935171401 2:100613610-100613632 GAGAGGCAGAAGGGTGGGAAGGG - Intergenic
935199595 2:100844858-100844880 CAGAGAGTCAAGGGTGAGGAAGG + Intronic
935319467 2:101871784-101871806 CAGAGAAAGCAGGGTGGGAAGGG - Intronic
935380448 2:102446450-102446472 CTGAGGGAGAAGGGTGGGAGGGG - Intronic
935690266 2:105724967-105724989 CATAGGGGAAAGGGTGGGAAGGG + Intergenic
935747010 2:106197246-106197268 CAGAGGGTGAAGGGGAAGCAAGG - Intergenic
936439275 2:112536674-112536696 AAGAGGGAGAAGGGAGGGAGGGG - Exonic
937283648 2:120736634-120736656 CAGGGGGTGGAGGGTGGGATCGG + Intronic
937849692 2:126621244-126621266 CAGAGGGTCAAGGATGGGAGTGG + Intergenic
937872091 2:126793183-126793205 CAGAGGGAGGTGGGCGGGAAAGG + Intergenic
937897084 2:126985600-126985622 CAGAGCGGGGAGGGAGGGAAGGG - Intergenic
937916020 2:127099098-127099120 TTGAGGGTGCAGGGTGGGAGCGG - Intronic
938142793 2:128810653-128810675 CAGAAGGTGAAGGAGGAGAAAGG - Intergenic
938294807 2:130171611-130171633 CAGAGGGTGGAGGGGAGAAAGGG - Intronic
938337763 2:130514302-130514324 CAAAGGGTGAAGGGGTGGCAGGG - Intergenic
938352076 2:130606433-130606455 CAAAGGGTGAAGGGGTGGCAGGG + Intergenic
938461824 2:131502233-131502255 CAGAGGGTGGAGGGGAGAAAGGG + Intergenic
938539263 2:132273127-132273149 AAGGGGGTGAGGGGTGGGGACGG - Intergenic
938746977 2:134288819-134288841 GAGAGGGAGAAGAGTGGGAAGGG - Intronic
939501263 2:142987949-142987971 CAGAGGGTGAAGGGGGAGGCAGG - Intronic
939862231 2:147434166-147434188 CAGAGGGTGAAGGATTGGATCGG + Intergenic
939940676 2:148347267-148347289 CAGAGGCTGAAGCGGGCGAATGG + Intronic
939955195 2:148521891-148521913 AAGGGGGTGAAGGGTGGGGGTGG + Intergenic
940707100 2:157119057-157119079 CTCAGGGGAAAGGGTGGGAAGGG - Intergenic
942062878 2:172244079-172244101 CAGGGGGTGAAGGGAGGAAGGGG - Intergenic
942213479 2:173694901-173694923 CGGTGGGAGAAGGGTGGGAGGGG + Intergenic
942290518 2:174465464-174465486 CAGATGGAGAAAGGCGGGAATGG - Intronic
942503174 2:176613749-176613771 ATGAGGGTGGAGGGTGGAAATGG + Intergenic
942635662 2:178002061-178002083 TAGAGGGGGAAGGGAGGGAGAGG - Intronic
942744038 2:179211850-179211872 CTCAGGGGGAAGGGTGGGAGGGG + Intronic
942908209 2:181208543-181208565 GAGAGGCTGAAAGATGGGAAAGG - Intergenic
943122740 2:183757401-183757423 CTCAGGGGGAAGGGTGGGAGGGG + Intergenic
943322628 2:186464456-186464478 CAGAAGTAGGAGGGTGGGAAGGG + Intergenic
943654781 2:190496903-190496925 CTCAGGGGAAAGGGTGGGAAAGG + Intronic
944142787 2:196475394-196475416 AAGAGAGTGAAGGGAGGGGAGGG + Intronic
944365458 2:198913748-198913770 CAGTGGGTGATGGGGAGGAAGGG + Intergenic
944377060 2:199057822-199057844 GAGAGGCTGAAAGGTGGGAGAGG + Intergenic
944493998 2:200288067-200288089 CAGAGGGTGGAGGGTGGAAGAGG - Intergenic
944604749 2:201342554-201342576 CAGTGGAAGAGGGGTGGGAAGGG - Intronic
945242257 2:207686855-207686877 GGGAAGGGGAAGGGTGGGAAGGG + Intergenic
945664568 2:212724603-212724625 CAGAAGGTGAAGGAGGAGAAAGG - Intergenic
945735216 2:213590344-213590366 GGGAGGGTGAATGGAGGGAAAGG - Intronic
945770865 2:214040432-214040454 GGGAGGGTAAAGGGTGGGAGTGG - Intronic
945815144 2:214596366-214596388 CTCAGGGGAAAGGGTGGGAAGGG + Intergenic
945951330 2:216041708-216041730 CAGAGGTTGTGGGGTGGGTATGG - Intronic
946090016 2:217213516-217213538 CGGAGGGTGGAAGGAGGGAAAGG + Intergenic
946135973 2:217647303-217647325 CATAGGGTGGAGGGTAGGTAAGG - Intronic
946415707 2:219538673-219538695 CTGAGCTTGGAGGGTGGGAAGGG + Exonic
946549822 2:220789048-220789070 CAGAAGGTGAAGGGGAAGAAAGG + Intergenic
947174279 2:227347100-227347122 GGGAGAGTGAAGGGTGGGAAAGG + Intronic
947181318 2:227413812-227413834 CAGATGAGAAAGGGTGGGAAGGG + Intergenic
947280928 2:228453988-228454010 CAGAGGGAGAGGGGTGGGAGGGG - Intergenic
947854700 2:233315165-233315187 CTGAGGGAGCTGGGTGGGAAGGG - Intronic
948355562 2:237374509-237374531 CAGCTGGCGAAAGGTGGGAATGG + Exonic
948907461 2:240986632-240986654 CGCAGGGGGAGGGGTGGGAAGGG + Intronic
1169001636 20:2172219-2172241 CAGAGGGAGCAGGGAGGGCAAGG - Intronic
1169207251 20:3747506-3747528 GAGAGGGATAAGGGTGTGAATGG - Intronic
1169766775 20:9155096-9155118 CAGAAGGGGAAGGGTGGGAGGGG - Intronic
1169814905 20:9646307-9646329 CAGGGAGTGAAGGCTGTGAATGG - Intronic
1169819985 20:9699827-9699849 CAGTTGGTGAAGGGTTGGAAGGG + Intronic
1169927398 20:10796984-10797006 CAAAGGGTGTAGGGGAGGAAAGG - Intergenic
1170184047 20:13567266-13567288 CTGAGGGTGAAGGGTGGGAGGGG + Intronic
1170345963 20:15387500-15387522 AAGAGGGGGAAGGGGGGAAAAGG - Intronic
1170350448 20:15435015-15435037 TTGAGGGTGACGGGTGGGAGGGG + Intronic
1170927606 20:20740131-20740153 CGCAGGGTAAAGGGTGGGAGGGG + Intergenic
1171122769 20:22580384-22580406 TCCAGGGAGAAGGGTGGGAAAGG + Intergenic
1171211860 20:23323064-23323086 CAGAAGGGGTAGGGTGGGAGGGG + Intergenic
1171573042 20:26271875-26271897 CAGAGGCTGAAGTGGGAGAATGG - Intergenic
1171989257 20:31683256-31683278 CAGAGGCCAAAGGGTGGGAATGG - Intronic
1172007721 20:31828928-31828950 CAGTGGGAGAGGGGAGGGAAAGG + Intronic
1172100076 20:32480031-32480053 CAGAGGGGAAATGGTGGAAATGG + Intronic
1172287833 20:33753429-33753451 CAGAGGGGGCAGGGTGGAAGAGG + Intronic
1172331532 20:34079091-34079113 CAGAGGGTGATGATTGTGAAGGG + Intronic
1172354909 20:34272949-34272971 CATAGGGTGAGGTATGGGAAGGG + Intergenic
1172805580 20:37609418-37609440 CAGAGGGTGAAGGGAGCTCAAGG - Intergenic
1172872907 20:38146973-38146995 CAGGGGGTGAAAGCTGGGGAGGG + Intronic
1172887165 20:38239164-38239186 CAGAGGGTCAAGGCAGGGGAAGG - Intronic
1173666394 20:44766335-44766357 CAGAGGGTGAAGGGGGAGCAGGG + Intronic
1174251716 20:49224844-49224866 CAGAGGCTGAAGTGTGGCATTGG + Intronic
1174385765 20:50187758-50187780 CAGGGGGTGGAGGGTGGGGAAGG + Intergenic
1174471794 20:50767008-50767030 CAGAGGGTGAGGGGGAGGCAGGG + Intergenic
1174909707 20:54593991-54594013 CTGAGGGTGGAGGATGGGGAAGG + Intronic
1175076458 20:56378866-56378888 CAGAGATGGAAGGGTTGGAAGGG + Intronic
1175198234 20:57260949-57260971 CAGATGGGGAAGGGTGGAGACGG + Intronic
1175283181 20:57819076-57819098 CCGAGGGTTATGGGAGGGAAAGG + Intergenic
1175341536 20:58233816-58233838 CTGCGGGGGAAGGGTGGGAGGGG - Intergenic
1175373310 20:58507484-58507506 CAGAGGGAGAAGGAGAGGAAGGG - Intronic
1175574389 20:60049913-60049935 AAGAGGGTGAAGGAAGGGAGTGG - Intergenic
1175645308 20:60665929-60665951 CTCAGGGGAAAGGGTGGGAAGGG + Intergenic
1175907586 20:62388572-62388594 CAGTGGGTGACGGGTGGGGTAGG + Intergenic
1175930318 20:62490725-62490747 GTGAGGGTGAGGGGTGGGCAGGG - Intergenic
1175948809 20:62571685-62571707 CAGAGGGAGAGGGAAGGGAAGGG - Intergenic
1176057141 20:63154834-63154856 AAGGGGGAGGAGGGTGGGAAAGG - Intergenic
1176305898 21:5122995-5123017 CAGAGGGTGCAGAGTGGCCACGG + Intronic
1176525284 21:7861712-7861734 CTGAGTCAGAAGGGTGGGAAAGG + Intergenic
1176525407 21:7862942-7862964 CTCAGGGGGAAGGGTGGGAGGGG - Intergenic
1176546203 21:8201312-8201334 GAGGGGGTGTAGGGTGGGGATGG + Intergenic
1176565154 21:8384358-8384380 GAGGGGGTGTAGGGTGGGGATGG + Intergenic
1176866382 21:14057038-14057060 CACAGGGTGAAGGCAGGGCATGG + Intergenic
1177098447 21:16868786-16868808 CAGAGGCTGAGGGTGGGGAAAGG + Intergenic
1177128159 21:17222166-17222188 CTCAGGGGTAAGGGTGGGAATGG + Intergenic
1177216743 21:18139853-18139875 GATAGGGAGAAAGGTGGGAATGG + Intronic
1177540268 21:22483891-22483913 CAGAGGGTGGAGTTGGGGAAGGG - Intergenic
1177567106 21:22838175-22838197 CAGAGGGGGAAGGGAAGGAAGGG + Intergenic
1177767481 21:25474723-25474745 CAGAGGGTGAAGGGAAAGCAAGG - Intergenic
1178099109 21:29247094-29247116 GAAAGGTGGAAGGGTGGGAAGGG - Intronic
1178135238 21:29619475-29619497 CAGGGGGAAAAGAGTGGGAAGGG + Intronic
1178239701 21:30884968-30884990 CAGAGCGTGAAGTGAGGGGATGG + Intergenic
1178369364 21:32014651-32014673 CTGAGAGAGAAGGTTGGGAAGGG - Intronic
1178390605 21:32194887-32194909 CAAAGGTGGGAGGGTGGGAAGGG + Intergenic
1178426048 21:32479128-32479150 CAGAAGGTGCAGGCTGGGAGCGG + Intronic
1178465394 21:32843017-32843039 CAGAAGGGGAAGGTTGGTAAAGG + Intergenic
1178659304 21:34491725-34491747 CTGAGTCAGAAGGGTGGGAAAGG + Intergenic
1178659427 21:34492955-34492977 CTCAGGGGGAAGGGTGGGAGGGG - Intergenic
1178828710 21:36037012-36037034 CAGAGGCTGAGGGGTTGGAGAGG + Intronic
1178935909 21:36861530-36861552 TAGAGGGTGAAAGGAGGGAGAGG - Intronic
1179070083 21:38063486-38063508 CAGAAGGTGAAGGGGAGGCAAGG + Intronic
1179351965 21:40620426-40620448 GGGAGGGGGAAGGGAGGGAAAGG + Intronic
1179524263 21:41965552-41965574 CAGGGGGTGGTGGGTGGGAGTGG + Intergenic
1179585916 21:42374045-42374067 CAGAGGGCAAAGGGCAGGAAAGG - Intronic
1179654672 21:42837778-42837800 CAGAGGGCGGAGGGTGGGGAGGG - Intergenic
1179851159 21:44139036-44139058 CAGAGGGTGCAGAGTGGCCACGG - Intronic
1180457244 22:15520890-15520912 GAGAGGGAGAAAGGTGGGGAGGG - Intergenic
1180607360 22:17068800-17068822 CAGTGGGTGAAGGGGGAGAAGGG - Intergenic
1180766002 22:18346239-18346261 CTGAGGGATCAGGGTGGGAAGGG - Intergenic
1180780311 22:18516139-18516161 CTGAGGGATCAGGGTGGGAAGGG + Intergenic
1180813027 22:18773460-18773482 CTGAGGGATCAGGGTGGGAAGGG + Intergenic
1181114075 22:20620488-20620510 CAGAGGGTGGAGGGGAGAAAGGG - Intergenic
1181199205 22:21207776-21207798 CTGAGGGATCAGGGTGGGAAGGG + Intergenic
1181648832 22:24247806-24247828 CTGAGGGATCAGGGTGGGAAGGG + Intergenic
1181702540 22:24629179-24629201 CCGAGGGATCAGGGTGGGAAGGG - Intergenic
1181788472 22:25244444-25244466 CAGAGGGTGAAGGGGAGCCATGG - Intergenic
1181820153 22:25469142-25469164 CAGAGGGTGAAGGGGAGCCATGG - Intergenic
1182130380 22:27845925-27845947 CCAAGGATGAGGGGTGGGAAGGG + Intergenic
1182555645 22:31127121-31127143 TAAAGGGTGGAGGATGGGAAGGG - Intronic
1182681447 22:32082990-32083012 TAGAGGGTGGAGAGTGGGGAAGG + Intronic
1182818962 22:33196785-33196807 AAGAGGGAGGAGGGTGAGAAAGG + Intronic
1182948688 22:34350268-34350290 CACACAGTCAAGGGTGGGAATGG + Intergenic
1183568376 22:38633015-38633037 CAGATGGGGCAAGGTGGGAAAGG + Intronic
1183629022 22:39021967-39021989 GAGAGGGTGTGGGGAGGGAATGG + Intronic
1183632453 22:39041416-39041438 GAGAGGGTGTGGGGAGGGAATGG + Intronic
1183638275 22:39077812-39077834 GAGAGGGTGTGGGGAGGGAATGG + Intronic
1183753271 22:39734824-39734846 TAGAGGCAGAAGGGTGAGAAAGG - Intergenic
1184255766 22:43285968-43285990 CAGAGGGAGAGGGGAGGGAGAGG - Intronic
1184298248 22:43539869-43539891 GAGCGGGTGCAAGGTGGGAAAGG - Intronic
1184427524 22:44421716-44421738 CAGAGGGGAAGGGATGGGAAGGG - Intergenic
1184492261 22:44816427-44816449 CACAGGGACAAGGGTGGGACGGG - Intronic
1184584936 22:45441528-45441550 CATGGGGTGAAGGTTGGGGATGG + Intergenic
1184642443 22:45879613-45879635 AAGGGGGGGAAGGGAGGGAAGGG - Intergenic
1184764342 22:46563858-46563880 CACGGGGTGGAGGCTGGGAAGGG - Intergenic
1185012062 22:48319809-48319831 GAGAGGGTCAGGGGTGGGAACGG - Intergenic
1185174142 22:49310273-49310295 AAGAGAGAGAAGGGAGGGAAGGG + Intergenic
1185214045 22:49588282-49588304 CAGAGGGTCCAGGGTGGGGCTGG - Intronic
1185229791 22:49673519-49673541 GAGAGGGGGAAGGAGGGGAAGGG + Intergenic
1185337418 22:50276789-50276811 CAGGGGGTCGAGGGTGGGCATGG + Intronic
1203227620 22_KI270731v1_random:87130-87152 CTGAGGGATCAGGGTGGGAAGGG - Intergenic
1203251075 22_KI270733v1_random:117549-117571 GAGGGGGTGTAGGGTGGGGATGG + Intergenic
949204667 3:1423658-1423680 CTGGGGGTGGGGGGTGGGAAGGG + Intergenic
949393809 3:3593098-3593120 CGGAGGGTGGAGGGTAGGAGGGG + Intergenic
949402365 3:3679090-3679112 CAGAAGTTCAAAGGTGGGAAAGG - Intergenic
949493498 3:4610893-4610915 GAGAAGGAGAAGGGGGGGAAGGG - Intronic
949551496 3:5115959-5115981 CAGAAGGGGAGGGGAGGGAAGGG - Intergenic
949657350 3:6235863-6235885 CAGAAGGTGAAGGAGGAGAAAGG - Intergenic
949720367 3:6982293-6982315 AAGAGGGAGAAGGGTAGGAGGGG + Intronic
950289077 3:11769038-11769060 CAGAGGGTGGAGGGGAGGAGTGG + Intergenic
950519054 3:13485416-13485438 CCGAGGGTGAGGGGAAGGAAGGG + Intronic
950644894 3:14371311-14371333 AAGAGGCTGAGAGGTGGGAATGG - Intergenic
950707455 3:14791839-14791861 CAGGGGATGAATGGAGGGAAGGG + Intergenic
951094608 3:18614016-18614038 CTCAGGGGGAAGGGTGGGAAGGG + Intergenic
951268882 3:20601949-20601971 CAGAGGGCGTGGGGTGGGATGGG + Intergenic
951390397 3:22096154-22096176 TAGAGGGGGAAGGGAGGGCAGGG + Intronic
951407057 3:22314268-22314290 CAGTGGGGAAAGGGTAGGAAGGG - Intronic
951508279 3:23473580-23473602 CAGTGGGGAAAGGGTGGGAAGGG - Intronic
951775146 3:26301922-26301944 CGGAGGGTGAGAGGAGGGAAAGG - Intergenic
952085524 3:29815781-29815803 AGGAGGGAGAAGGGTGGGAGGGG + Intronic
952096923 3:29964868-29964890 CAAAGGGGGAAGAGTGGGAGGGG - Intronic
952503910 3:33989896-33989918 CAGAGGGAAAAGAGTGGGGACGG - Intergenic
952915551 3:38236879-38236901 CAGAGGATGGAGGCTGGGAGTGG + Exonic
952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG + Exonic
952981333 3:38738511-38738533 CAGAGGTTGAAGGGGGTGCATGG - Intronic
953489422 3:43336258-43336280 GAGAGGGTGGAGGGAGGGTAAGG - Intronic
953606669 3:44417117-44417139 GAAAGTGTGAAGGGTGGGCAGGG - Intergenic
953610345 3:44442658-44442680 GAGTGGGGGAAAGGTGGGAAGGG + Exonic
953852090 3:46472085-46472107 GGGAGGGAGAAGGGAGGGAAGGG - Intronic
953913473 3:46904325-46904347 CAGCAGGTGAAGGGTGGGCTGGG + Intergenic
953980855 3:47412332-47412354 CAGGAGGTGGAGGCTGGGAACGG + Exonic
954635593 3:52069140-52069162 CCCAGGGAGATGGGTGGGAATGG - Intergenic
954638692 3:52085371-52085393 CAGAGGGTGAAGGGTGTCCCAGG - Intronic
955034129 3:55249833-55249855 CAGAGGGTGGGAGGAGGGAAAGG - Intergenic
955896047 3:63701068-63701090 TAGAGGGGGAAGGGAGGGAAGGG + Intergenic
956015619 3:64879677-64879699 CTTAGGGGGAAGGGTGGGAGGGG + Intergenic
956245711 3:67180731-67180753 AAGAGAGAGAAGGATGGGAAGGG - Intergenic
956378861 3:68644882-68644904 CAGAGGGTTTGGCGTGGGAATGG - Intergenic
956570636 3:70690632-70690654 CTCAGGGGAAAGGGTGGGAAGGG - Intergenic
956861782 3:73331424-73331446 CTTAGGGGAAAGGGTGGGAAGGG - Intergenic
957227708 3:77471283-77471305 GAGAGGGTTTGGGGTGGGAAAGG + Intronic
957349055 3:78999540-78999562 CAGAGGGGAAAGGAAGGGAAAGG + Intronic
957447390 3:80331660-80331682 CAGAGGGTGGAGGGTGGAAGAGG - Intergenic
958009132 3:87853217-87853239 TTGAGGGTGGAGGGTGGGAGTGG - Intergenic
958014301 3:87920243-87920265 CTCAGGGGAAAGGGTGGGAAGGG + Intergenic
958082303 3:88761998-88762020 CTCAGGGTGAAAGGTGGGAGGGG + Intergenic
958436337 3:94100466-94100488 CTGAGGGTGAAGGGAAGGATGGG + Intronic
958484478 3:94686339-94686361 CAGAAGGGGGAGAGTGGGAAGGG + Intergenic
959209900 3:103364709-103364731 CAGAGGGTAGAGGGTGGGAGGGG + Intergenic
959424310 3:106167286-106167308 GAAAGGGTGGAGGGTGGCAAGGG + Intergenic
959546340 3:107601192-107601214 CTGAGGGAGAAAGATGGGAACGG - Intronic
959646931 3:108713700-108713722 TTGAGGGTGAAGGAGGGGAAGGG + Intergenic
960085671 3:113588597-113588619 CTGAGGCTGGAGGATGGGAAGGG - Intronic
960100229 3:113734300-113734322 AAGAGGGAGAAGGGAGGGAGGGG + Intronic
960506975 3:118505603-118505625 CAGAAGGTGCAGGTGGGGAATGG - Intergenic
960532689 3:118782702-118782724 CAGAGGGAGAAGGAGGGCAAAGG + Intergenic
960571283 3:119187705-119187727 AAGGGGGTGGAGGGTGGGGAAGG - Intronic
960985725 3:123279360-123279382 CAGAGGGTCCAGAGAGGGAAGGG - Intergenic
961066367 3:123880594-123880616 CAGAGGGTGGAAGGGGGGCAAGG + Intronic
961107632 3:124255728-124255750 CAGATGGAGCAGGGTGGGGAGGG + Intronic
961366453 3:126402692-126402714 CCGAGGGGGAGGGGAGGGAAGGG + Intronic
961550523 3:127668341-127668363 CAGAGGGTTGAGGGTGAGTACGG + Intronic
961570583 3:127795393-127795415 TAGAGGGGGAAGGGAGGGAGGGG + Intronic
961853037 3:129840734-129840756 CAGAAGGTGAAGGGGAAGAAAGG - Intronic
961997169 3:131258158-131258180 CTCAGGGGGAAGGGTGGGAGGGG + Intronic
962116342 3:132512764-132512786 CTGAGGGTTAGGGGTGGGGATGG + Intronic
962460733 3:135610226-135610248 AAAAGGTAGAAGGGTGGGAAGGG - Intergenic
962460877 3:135611732-135611754 AAAAGGTAGAAGGGTGGGAAGGG - Intergenic
962504338 3:136030547-136030569 TAAGGGGTAAAGGGTGGGAAGGG - Intronic
962697621 3:137966417-137966439 GAAAGGGTGAGGGGTGGCAAAGG - Intergenic
963001684 3:140687514-140687536 CAGAGGGGGAAGAAGGGGAAGGG + Intronic
964110029 3:153078269-153078291 CACAGGGTGAGGGGTGGGACTGG + Intergenic
964586169 3:158305157-158305179 TAGAGGGTGAAAGGAGGGATTGG - Intronic
964623370 3:158736425-158736447 GAGGAGGGGAAGGGTGGGAATGG + Intronic
964712522 3:159686136-159686158 CTGAGCCTGAAGGGAGGGAATGG - Intronic
964837838 3:160959290-160959312 CATAAGGGGGAGGGTGGGAAGGG + Intronic
964993142 3:162840552-162840574 CAGAGGGTGGAGGGTAGGAAAGG - Intergenic
965039059 3:163482747-163482769 CAGAGGGAGAGGGGTGAGGAAGG - Intergenic
965120309 3:164546113-164546135 CAGAGTGGGGAGGGTGAGAAGGG + Intergenic
965404731 3:168254949-168254971 CAGAAGGTGAAGGGGAAGAAAGG + Intergenic
965700886 3:171458913-171458935 AAGGGGGTGAGGGGTGGGGATGG - Intronic
965722603 3:171678069-171678091 CAGAGTGGGAAGGGCGGGGAGGG + Intronic
966220947 3:177550481-177550503 CTCAGGGAAAAGGGTGGGAAGGG + Intergenic
966358590 3:179109198-179109220 GAGAGGGTGAATGGGGGGAGAGG + Intergenic
966483088 3:180433392-180433414 CAGAATGTGAAGGGAGGGGAAGG - Intergenic
966686508 3:182701643-182701665 TTGAGGGGGAAGGGTGGGAGGGG - Intergenic
966851737 3:184169013-184169035 CAGGGTGAGTAGGGTGGGAAGGG - Intronic
966979761 3:185121222-185121244 TTGAGGGGAAAGGGTGGGAAGGG + Intronic
967045165 3:185730119-185730141 CAAAGGGGAAAGGGTGGGAGTGG - Intronic
967817831 3:193814345-193814367 CTGAGTGTCAAGGGTAGGAAGGG - Intergenic
967994500 3:195156391-195156413 GAGAGGGTGAAGGGTGGGGAGGG + Intronic
968135155 3:196215497-196215519 CAGAGGGTCAATTCTGGGAAGGG - Intronic
969154879 4:5201692-5201714 CAGAAGGTGAAGGGGGAGCAAGG + Intronic
969408028 4:7007869-7007891 CCGTGGGTGGAGGGTGGGGAAGG - Intronic
969562518 4:7958637-7958659 CCGAGGGTGGGGGGTGGGAGGGG + Intergenic
969587529 4:8103082-8103104 CACAGGGTGCAGTGTGGGAGAGG + Intronic
970180518 4:13387091-13387113 AAGAGGATGGAGGGTGGGAGGGG + Intronic
970231670 4:13917214-13917236 AAGAGGTTGGAGGGTGGGAAGGG - Intergenic
970986133 4:22160957-22160979 CAAAGGCTGGAGGGTGGGAGGGG - Intergenic
971380324 4:26091292-26091314 CTCCGGGTGAAGGGTGGGAGCGG - Intergenic
971525565 4:27613637-27613659 TAGAGGGTGAATGGAGGGAGAGG - Intergenic
972045140 4:34655774-34655796 CGGAGGGTGGAGGGTGGAAATGG + Intergenic
972127825 4:35791027-35791049 AGTAGGGTGAAGGCTGGGAATGG - Intergenic
972406721 4:38753153-38753175 CTGGGGGTGGAGGGTGGGGAAGG + Intergenic
973122990 4:46546028-46546050 CAGAGGGTGAGGGCTGGGAGAGG - Intergenic
973674851 4:53254090-53254112 CTGAGGGTGGAGGGTGGAGAAGG + Intronic
974097478 4:57380259-57380281 CTTAGGGGGAAGGGTGGGAGGGG + Intergenic
974675573 4:65084453-65084475 CAGAGGGTGAGAGGAGGGAGAGG - Intergenic
975118822 4:70706280-70706302 TATAGGGTGTATGGTGGGAAAGG - Intronic
975400327 4:73929962-73929984 AGGAGGGTGGAGGGTGGGAGGGG + Intergenic
975598030 4:76068624-76068646 TTGAGGGTGGAGGGTGGGAAGGG + Intronic
975898688 4:79123910-79123932 CTGAGGTTGGAGGGTGGGACTGG - Intergenic
976001819 4:80383178-80383200 TTGAGGGTGGAGGGTGGGAGGGG + Intronic
976128282 4:81856460-81856482 CACAGGGTGAAATGTGGGAGAGG + Intronic
976132224 4:81896768-81896790 TTGAGGGTAAAGGGTGAGAAGGG - Intronic
976318423 4:83684353-83684375 CTCAGGGGGAAGGGTGGGAGGGG - Intergenic
976726275 4:88218594-88218616 CTCAGGGGAAAGGGTGGGAAGGG - Intronic
976778737 4:88735105-88735127 CACAGGGTGTGGGGTGGGAGTGG + Intronic
977350853 4:95885507-95885529 CAGTGGCAGAAGGGTGGCAAGGG + Intergenic
977403480 4:96564632-96564654 TAGAGGGTGAAAGGAGGGAGAGG - Intergenic
978503881 4:109435990-109436012 CAGAGGGTGCTGGGTGGCATGGG + Intronic
978702812 4:111669907-111669929 GAGAAGGTAGAGGGTGGGAAAGG - Intergenic
979168241 4:117564406-117564428 TGGAGGGGGAAGGGTGGGAGAGG - Intergenic
979534190 4:121801080-121801102 CAAAGGGTGAAGTGTGCGAGCGG + Intergenic
979700244 4:123658744-123658766 CAGAGGGGGAAGGATGAGGAGGG + Intergenic
979748697 4:124248777-124248799 CAGAGGGTGAAGTGAGGGAGGGG - Intergenic
980539113 4:134170555-134170577 CAGAAGGTGAAGGGGGAGCAAGG + Intergenic
981555619 4:145990393-145990415 CAGAGGGTGAAGGTGGCTAAGGG - Intergenic
981980017 4:150780808-150780830 AAGGGGGTGAGGGGGGGGAATGG + Intronic
981990046 4:150907307-150907329 GAGAGGGGGAAGGGAGGGAGGGG + Intronic
982641201 4:157963854-157963876 ATGAGGGTGAAGGGTAGGATGGG + Intergenic
982761427 4:159288978-159289000 TAGATGGTGATGGCTGGGAATGG - Intronic
982817627 4:159906243-159906265 GTCAGGGTGAGGGGTGGGAAAGG + Intergenic
982898000 4:160958885-160958907 CAAAGAATGAAGGGTGGAAATGG + Intergenic
983049974 4:163034500-163034522 GGGAGGGGAAAGGGTGGGAAGGG + Intergenic
983147533 4:164235730-164235752 CAGAAGGGGAAGAGTGGGAGGGG + Intronic
983283323 4:165708512-165708534 CAGAGGGTGGAAGGAGGGAGAGG - Intergenic
984466841 4:180110521-180110543 CACACTGTGAAGGGTGTGAAGGG - Intergenic
984811807 4:183801868-183801890 GTGAGGGTGAAGGGTGGGACTGG + Intergenic
985036617 4:185846811-185846833 GAGAGGGGGAAGGGGGAGAATGG + Intronic
985356560 4:189126038-189126060 CAGAGGGTGGAGGGTGCGGAGGG - Intergenic
985393988 4:189521994-189522016 CAGAAGGGGAAGGTTGGGAGTGG - Intergenic
985531173 5:434567-434589 CACAGTGTGCAGGGTGGAAAGGG - Exonic
985544745 5:503982-504004 GAGAGGGTGAAGTGTGAGGAAGG - Intronic
985576414 5:675385-675407 CAGAGGGTGCAGTGTGGCCAGGG + Intronic
985877807 5:2613422-2613444 CAGAGGGTGAGGGGAAGGGAGGG - Intergenic
986054329 5:4120890-4120912 CAGAGGGTGGATGGTGGGGAGGG + Intergenic
986152974 5:5144763-5144785 CAGAGACAGAAGGGTGGGACAGG - Intronic
986263732 5:6174140-6174162 CAGAGGCTGGAGGGAAGGAATGG + Intergenic
986435841 5:7730028-7730050 CAAAGGGGGAAGGGTAGGAGAGG - Intronic
986452979 5:7884665-7884687 CAGGGTGTGGAGGGTAGGAAGGG - Intronic
986826411 5:11527470-11527492 TAGAGGTGGATGGGTGGGAAGGG - Intronic
987079799 5:14416739-14416761 GGGTGGGGGAAGGGTGGGAAGGG - Intronic
987214274 5:15716555-15716577 CAGAGGAAGAATGGTGAGAAAGG - Intronic
987458099 5:18171717-18171739 CAGAGGGGGAAGGAAGGGAGAGG + Intergenic
987762592 5:22184997-22185019 CAGAGAGGGTAGGGTGGGAGAGG - Intronic
987966911 5:24889339-24889361 CAGAAGGTAAAGGGGGAGAAAGG - Intergenic
988136372 5:27176276-27176298 CAGAAGGTGAAGGGGAAGAAGGG + Intergenic
988279327 5:29126076-29126098 CAGAGGCAGAAGAATGGGAATGG + Intergenic
988294008 5:29330998-29331020 AAGAGGGAGAGGGGTGGGACAGG - Intergenic
988294141 5:29333020-29333042 CAGAGGGTGGAGGGGGAGGAAGG - Intergenic
988458851 5:31413983-31414005 CAGTGAGAGAAGGGTGGGAAAGG + Intronic
989142296 5:38213661-38213683 CAGCGCGTGTAGGGTGGGAAGGG + Intergenic
989155961 5:38345017-38345039 CAGACTGTGAATGGAGGGAATGG + Intronic
989359313 5:40582115-40582137 AGGAGGGTGAGGGATGGGAAAGG + Intergenic
989461341 5:41702630-41702652 TTGAGGGTGGAGGTTGGGAAGGG - Intergenic
989525328 5:42447292-42447314 CTCAGGGAGAAGGGTGGGAGGGG - Intronic
989794665 5:45452550-45452572 TTGAGGGTGGAGGGTGGGAGAGG - Intronic
990312466 5:54553049-54553071 GAGTGGGAGAAGGGTGGGAGGGG + Intergenic
990358308 5:54992926-54992948 CTCAGGGGAAAGGGTGGGAAGGG + Intronic
990413922 5:55567896-55567918 CTTAGGGGGAAGGGTGGGAAAGG - Intergenic
990641797 5:57793947-57793969 TAGAGGGGGAAGGGAGGGAGGGG - Intergenic
991247197 5:64520786-64520808 CAGGGGGTGAGGGTGGGGAATGG + Intronic
991328351 5:65463387-65463409 CAGTGACTGAAGGGAGGGAAGGG + Intronic
991514633 5:67421167-67421189 GAGAGGGTGAAGGTGGAGAAGGG - Intergenic
991519579 5:67480884-67480906 CAGAGGGTGTAGTGGGGGAGAGG + Intergenic
991897383 5:71418382-71418404 CAGAGAGGGTAGGGTGGGAGAGG - Intergenic
992006735 5:72485826-72485848 CAGAGGCTGGAGAGTGGGAGTGG - Intronic
992093330 5:73338853-73338875 GAGAGGGAGGAGGGTGGGAGAGG + Intergenic
992205115 5:74423469-74423491 CAGAGGAGGAAGGGAGGCAAGGG + Intergenic
992232563 5:74677848-74677870 CAGAAAGGGGAGGGTGGGAAAGG - Intronic
992351123 5:75930158-75930180 CAGGGGGAGAAGCGGGGGAAGGG - Intergenic
992553884 5:77884849-77884871 AAGAGGGCGGAGGGTGGAAAAGG + Intergenic
992754729 5:79893539-79893561 TAGAGGGTAAAAAGTGGGAAGGG + Intergenic
993170670 5:84415179-84415201 CAGTGGGTGAAGTCTGGGAGAGG - Intergenic
993207659 5:84904717-84904739 CATAGGTTGGAGGGTGGGCAGGG + Intergenic
993223357 5:85132863-85132885 TAGAGGGGGAAGGGAGGGAGAGG - Intergenic
993390956 5:87319323-87319345 CAGAGGGGGAAATGTGGGACTGG - Intronic
993633860 5:90320344-90320366 CAGAGGGTGGAAGGAGGCAAAGG - Intergenic
993875621 5:93303433-93303455 CAGAGGGTGGAGGGTGGAGAAGG - Intergenic
994006811 5:94846972-94846994 CTGATGCTGTAGGGTGGGAATGG - Intronic
994448543 5:99909719-99909741 CAGAGGGTGAAGAGAGGAATGGG + Intergenic
994645697 5:102466165-102466187 CAGAGGGTGGGGGGAGGAAAAGG - Intronic
995094360 5:108217776-108217798 CAGATGCTGAAGGGAGGGAAAGG - Intronic
995170619 5:109107469-109107491 TAGAGGGTGGAGGGAGGGAGAGG - Intronic
995188762 5:109298594-109298616 CAGGGGGTGGAGGGAGGTAAGGG - Intergenic
995472077 5:112513226-112513248 GAGATGGGGAAGAGTGGGAAAGG - Intergenic
995749561 5:115440054-115440076 CAGAGGGAGAAGGGTGGAGAAGG - Intergenic
996031195 5:118705594-118705616 GAAAGGTTGAAGTGTGGGAAGGG + Intergenic
996785444 5:127231880-127231902 CAGACTGAGAAGCGTGGGAAGGG + Intergenic
996977723 5:129455357-129455379 CATAGGGTGAGTGGTGGGACGGG - Intergenic
997259611 5:132455846-132455868 CAGAGGTTGGAGGCTGGGAGGGG + Intronic
997917721 5:137944948-137944970 TAGAGGGGGAAGGGAGGGAGGGG + Intronic
998353493 5:141515999-141516021 CAGAGGGTGAGGTGTTGGGATGG + Exonic
998634827 5:143941925-143941947 CAAGGGGAAAAGGGTGGGAAGGG - Intergenic
998798398 5:145843109-145843131 CAGATACTGAAGGGTTGGAATGG + Intergenic
999116619 5:149169718-149169740 CAGTGGGGGAATGGTGGGAGAGG - Intronic
999174978 5:149625739-149625761 GAGAGGTGGGAGGGTGGGAAGGG - Intronic
999230078 5:150056578-150056600 CAGAGGACAAAGGGTGAGAAGGG - Intronic
999371384 5:151057276-151057298 GTGAGGTTGAAGGGAGGGAAGGG - Intronic
999540324 5:152564382-152564404 GAGAGGGATAAGTGTGGGAAAGG + Intergenic
999726856 5:154445356-154445378 CAGAGTGTGGAGAGTGGGACTGG - Intergenic
999825236 5:155267340-155267362 CAGAGGGTGGAGGGTGGGATGGG - Intergenic
999853571 5:155569098-155569120 TAGAGGGGAAAGGGAGGGAAAGG - Intergenic
999968517 5:156835441-156835463 CAGAGGGAGAGGGGTAAGAATGG - Intergenic
1000185282 5:158851977-158851999 GAGGGGGAGAAGGGAGGGAAGGG + Intronic
1000198119 5:158979906-158979928 CAGAGAGTGAACGCAGGGAAGGG - Intronic
1000491418 5:161918874-161918896 CAGAGGGGGAAGGGTGGAAAGGG + Intergenic
1000521558 5:162300462-162300484 CAGAGGGTTTGGTGTGGGAAAGG - Intergenic
1000610978 5:163373964-163373986 CAGAGGGTGAAAGGGGGCAGGGG + Intergenic
1000774791 5:165406311-165406333 TGGAGGGTGGAGGGAGGGAAGGG - Intergenic
1000779033 5:165456531-165456553 CTGAGGGTGAAGGGTGGGAGGGG - Intergenic
1001092794 5:168753808-168753830 CAGAGGGAGACGGGAGGGCAGGG - Intronic
1001444464 5:171772755-171772777 TTTAGGGTGGAGGGTGGGAAAGG - Intergenic
1001521234 5:172395051-172395073 CAGAGGGTGAATGAGGAGAAGGG - Intronic
1001561963 5:172675620-172675642 CACAGGGAGAAGGGAGGGAAGGG - Intronic
1001673151 5:173491050-173491072 GAGAGGGTGAAGAATGGGTAGGG + Intergenic
1001799616 5:174531607-174531629 CAGGGGCTGGAGGGTGGGGAAGG + Intergenic
1001816442 5:174673210-174673232 CAGAGGGCAAATGGTGGGAAGGG - Intergenic
1001831394 5:174792263-174792285 CAGAGTGTGGAGGGTAGGAGTGG - Intergenic
1001895145 5:175372353-175372375 TTGAGGGTGAAGGGTGGGAGTGG - Intergenic
1002067239 5:176657974-176657996 AAGAGGGTGCAGCCTGGGAAGGG + Exonic
1002451351 5:179320611-179320633 CAGAAGGAGAAGGGTGGGCCAGG - Intronic
1002665087 5:180817124-180817146 TGGAGGGAGAAGGGTGGGAGAGG + Intergenic
1002872125 6:1176675-1176697 CAGCAGCTGAAGGGAGGGAAGGG - Intergenic
1003042684 6:2702474-2702496 TAGAGGTTGAAGGGTGGGGTGGG + Intronic
1003592208 6:7445826-7445848 CAGAGGGTGAAGAGTCAGAAGGG + Intergenic
1004039421 6:11961068-11961090 CAGAGGGTGCAGGGTTAGAAAGG - Intergenic
1004296408 6:14415854-14415876 CAGAAGGTGAAGGGGAGGCAAGG - Intergenic
1004625288 6:17370551-17370573 CTCAGGGGGAAGGGTGGGATGGG - Intergenic
1004984076 6:21059908-21059930 CAGAAGGGGGAGGGTGGGACAGG - Intronic
1005011950 6:21344226-21344248 CTGAGGGGCAAGGCTGGGAAAGG + Intergenic
1005199142 6:23323432-23323454 TTGAGGGTGAAGGGTGACAAGGG + Intergenic
1005568259 6:27118225-27118247 CTGAGGGTGAAGTATTGGAAAGG - Intergenic
1006203740 6:32320829-32320851 CAGAGGGTGGAGGGTGGGAGCGG - Intronic
1006219934 6:32480252-32480274 CCAAGGGTGATGGGAGGGAAGGG + Intergenic
1006224371 6:32524024-32524046 CCAAGGGTGATGGGAGGGAAAGG + Intronic
1006229219 6:32567999-32568021 CCAAGGGTGATGGGAGGGAAGGG + Intronic
1006401067 6:33817710-33817732 CAGTGGGAGAAGGGTTGGAGAGG - Intergenic
1006603083 6:35238739-35238761 CTGAGGGAGAATGGGGGGAAAGG + Intronic
1006770331 6:36547533-36547555 CAGGGGGTGAAGGGAGGGGCAGG - Intergenic
1007040362 6:38715756-38715778 CAGAAGGGGAAGGGTGGGAGGGG + Intronic
1007097883 6:39225478-39225500 CAGAGGCAGAAGGTTGAGAAGGG + Intronic
1007110574 6:39311246-39311268 CACTGGGTAAAGGGTGGGGAAGG - Intronic
1007772795 6:44204689-44204711 AAGAGGGTGAGGGGAGGAAATGG - Intergenic
1007909616 6:45500653-45500675 GCCAGGGTGAATGGTGGGAATGG + Intronic
1008074454 6:47131399-47131421 CAGAGGATGTAGGCAGGGAAGGG - Intergenic
1008416237 6:51244068-51244090 CAGGGGGGAAAGGGTGGGAAGGG + Intergenic
1008493781 6:52112453-52112475 CAGAGGGAGTAGAGTGGGCATGG + Intergenic
1008863566 6:56181558-56181580 GACAGGGAGAAGGGTAGGAAGGG - Intronic
1008945286 6:57090164-57090186 CAGGCGGTGCAGGGCGGGAAGGG + Exonic
1009271369 6:61619253-61619275 CAGAAGGGGGAGGGTGGGGAGGG - Intergenic
1009798966 6:68508672-68508694 CTCAGGGGGAAGGGTAGGAAGGG - Intergenic
1010164510 6:72899798-72899820 CTTGGGGTGAAGGGTGGGAAGGG - Intronic
1010678329 6:78769798-78769820 CAGAGGGGGAAAGGTAGGGATGG + Intergenic
1010962250 6:82158546-82158568 CTCAGGGAGAAGGGTGGGAGGGG + Intergenic
1011106625 6:83788888-83788910 CAGAGAATGAAGGGTGGGGAAGG - Intergenic
1011187450 6:84694331-84694353 GAAAGGGTGAGGGGTGGTAAAGG + Intronic
1011238667 6:85246816-85246838 TGGAGGGGGAAGGGAGGGAAGGG - Intergenic
1011308183 6:85952502-85952524 CAGAAGGGGAAGGGTGGGAGGGG - Intergenic
1011352318 6:86435886-86435908 GAGAGGTTGAAGGGAGAGAATGG + Intergenic
1011686890 6:89830591-89830613 CTGAGGGAGATGGGGGGGAAAGG - Intronic
1011731523 6:90269242-90269264 CTGGGGGTGAGGGGTGGGAAGGG + Intronic
1011865468 6:91820636-91820658 CAGAGGGTGAAGTATGAAAAAGG - Intergenic
1011891860 6:92173773-92173795 CAAAGGGAGAAGTGTGGGGAAGG + Intergenic
1012014892 6:93837659-93837681 CAGAGGGTGAAGGGTGGTGAAGG + Intergenic
1012169043 6:95995480-95995502 CTCAGGGAGAAGGATGGGAAGGG + Intergenic
1013055150 6:106575919-106575941 CAGAGGGTGAGGTGTGTGAGGGG + Intronic
1013105248 6:107021579-107021601 CAGAAAGTGAATGGTGGCAAGGG + Intergenic
1013853940 6:114548942-114548964 CTGAGGGTGAAGGTTGAGAGAGG + Intergenic
1014022304 6:116605220-116605242 CTCAGGGGAAAGGGTGGGAAGGG + Intergenic
1014182326 6:118398744-118398766 CAGGGGATGAAGGGTGTGCAGGG - Intergenic
1014249275 6:119099192-119099214 CATAGGGTGAGGTATGGGAAGGG - Intronic
1014249363 6:119099793-119099815 CATAGGGTGAGGTATGGGAAGGG - Intronic
1014328353 6:120028049-120028071 CAGAGGGTGAAGTGGGAGCAAGG + Intergenic
1014393651 6:120896142-120896164 CAGAAGGGGGAGGGTGGGATAGG + Intergenic
1014699841 6:124671252-124671274 CAGAGGTTGTGGGGTGGGAAAGG - Intronic
1014966168 6:127754820-127754842 CAAAGGGTGAATGGTGGCAACGG + Intronic
1014985201 6:127998014-127998036 CAGTAAGTGAAGGGTGGCAAAGG + Intronic
1015180284 6:130354650-130354672 GTGAGGGTGAAGGGTGGGGAAGG + Intronic
1015645223 6:135379964-135379986 GAGAGGGTGAAGGGGAGGGAGGG - Intronic
1015664850 6:135617336-135617358 CAGAGGGAGAAGCTTGGGAAAGG + Intergenic
1015743399 6:136483356-136483378 TTGAGGGTGAAGGGCGGGAGGGG + Intronic
1015772635 6:136784624-136784646 CAGTGGCTGAAAGGTGGGAAGGG + Intronic
1016636287 6:146295870-146295892 TTGAGGGTGAAGGATGGGAGAGG - Intronic
1016638944 6:146326444-146326466 CAGAGGGTGAAAGGAGGGAGAGG + Intronic
1016652453 6:146478343-146478365 CAGAGGGTGGGAGGAGGGAAAGG - Intergenic
1016935092 6:149443677-149443699 CAGATGGAGAAGAGTGGGAGAGG + Intergenic
1016946169 6:149536216-149536238 GAGAGGGAGAAAGATGGGAATGG - Intronic
1017010903 6:150063502-150063524 AGGAGGGTGGAGGTTGGGAAAGG - Intronic
1017081814 6:150676901-150676923 GAGAGGGAGGAGGGAGGGAAAGG - Intronic
1017601961 6:156092965-156092987 TAGAGGGTGAAAGGAGGGAGAGG + Intergenic
1017759367 6:157556252-157556274 TGGGGGGTGGAGGGTGGGAAGGG + Intronic
1017762061 6:157577007-157577029 TTGAGGGTGGAGGGTGGGATGGG - Intronic
1017829581 6:158113959-158113981 GTGAGGGTGAGGGATGGGAAGGG - Intronic
1017923111 6:158888221-158888243 AAGAGAGAGAAGGGTGGGAAGGG + Intronic
1018001238 6:159580501-159580523 CAGAGGGCGATGGGTGAGGAGGG + Intergenic
1018129690 6:160717198-160717220 CAGAGGGTGAGTGGTGGGGGTGG + Intronic
1018176845 6:161184573-161184595 CAGAGGATGACAGGTGGGAATGG - Intronic
1018352673 6:162977544-162977566 CAGTCGGAGAAGGGTGGGATGGG - Intronic
1018484243 6:164224778-164224800 CAGAAGGTGAAGGGGGAGAGAGG + Intergenic
1018683180 6:166281740-166281762 CGGATGGTGAAGGGTGAGGATGG + Intergenic
1018817673 6:167347280-167347302 CAGAGGCTGAGGAGTGGGTAGGG + Intronic
1019289276 7:242447-242469 CAGAAGGAGGAGGGTGGGAAGGG + Intronic
1019484234 7:1281323-1281345 CAGAGGAAAAAGCGTGGGAACGG + Intergenic
1019643714 7:2118095-2118117 CACAGGGTGGAGGGTGGGTAAGG - Intronic
1020181026 7:5922521-5922543 CTGAGGGTGCAGGGAGGGGAGGG + Intronic
1020301907 7:6802367-6802389 CTGAGGGTGCAGGGAGGGGAGGG - Intronic
1020331861 7:7026643-7026665 CTTAGGGGGAAGGATGGGAAGGG - Intergenic
1020866382 7:13569308-13569330 GAATGGGTGTAGGGTGGGAAGGG - Intergenic
1021104164 7:16617673-16617695 CAGAGGATGAAGGGCAGGCATGG + Intronic
1021161014 7:17272693-17272715 CAGAGGCAGAAGGCTTGGAAAGG - Intergenic
1021585283 7:22201252-22201274 CAGAGGGTGGAAGGAGAGAAAGG - Intronic
1021607480 7:22422924-22422946 CTTACGGTGAAGGGTGTGAACGG + Intronic
1021888554 7:25164775-25164797 CTCAGGGGGAAGGTTGGGAAAGG - Intronic
1022228379 7:28387630-28387652 CAGAGGGTGGAGGGGGAGGAGGG + Intronic
1022459938 7:30595250-30595272 CAGAGGATGAAGGGAAAGAAAGG - Intronic
1023523554 7:41073458-41073480 CTGAGGGTGAAGCAGGGGAAGGG + Intergenic
1023805489 7:43869836-43869858 CCGAGGGTGCAGGTTGGGCAGGG - Intronic
1024637209 7:51300832-51300854 AAGTGGGGAAAGGGTGGGAAGGG - Intronic
1025603056 7:63017530-63017552 GAGAGGGTGCAGGGAAGGAAAGG - Intergenic
1026218726 7:68372976-68372998 CACGGGGGAAAGGGTGGGAAGGG - Intergenic
1026228428 7:68462856-68462878 GGGAGGGTGAAGGAAGGGAAGGG - Intergenic
1026577277 7:71582809-71582831 CTCAGGGGAAAGGGTGGGAAGGG + Intronic
1027408099 7:77884379-77884401 CAGAAGGGGTAGGGTGGGAAGGG - Intronic
1027444299 7:78255095-78255117 TAGAGAGAGAAGGGAGGGAAGGG - Intronic
1027982344 7:85241665-85241687 CAGTGGGGAAAGGGTAGGAAGGG + Intergenic
1028018045 7:85739475-85739497 CAGAAGGAGAAGAGAGGGAAGGG + Intergenic
1028162486 7:87501079-87501101 CAGAGGCTGCCTGGTGGGAAGGG - Intergenic
1028284998 7:88985472-88985494 CAGAGTGTAAAGGGTGTGAAGGG + Intronic
1028602335 7:92615865-92615887 TAGAAGGTGAAAGGAGGGAAAGG + Intronic
1028703343 7:93809242-93809264 CTTAGGGGGAAGGGTGGGAGGGG + Intronic
1029053655 7:97717044-97717066 AGGCGGGGGAAGGGTGGGAAGGG + Intergenic
1029115081 7:98232561-98232583 CAGAGGGTGGTGGGTGGGGAAGG - Intronic
1029420264 7:100468329-100468351 CGGGGAGTGAAGGGTGTGAAGGG + Intronic
1029510367 7:100990851-100990873 CTGAGGTTGCAGAGTGGGAAGGG - Exonic
1029646091 7:101856984-101857006 CAGAGGCTGAAGGATGGGAGAGG - Intronic
1029928467 7:104344409-104344431 CAGAAGGGGAAGGGTGGAAGTGG - Intronic
1031462113 7:122064291-122064313 CAGAGGGTGAGGGGTGCTACTGG + Intergenic
1031798950 7:126217441-126217463 CTCTGGGGGAAGGGTGGGAAGGG - Intergenic
1031873497 7:127112258-127112280 CTGAGGCTGAAGGATGAGAAAGG - Intronic
1032288788 7:130567240-130567262 TTGAGGGTGTAGGGTGGGAGAGG + Intronic
1032991878 7:137403012-137403034 CAGAGTGTGCAGGGTGGCGAAGG + Intronic
1033011848 7:137631583-137631605 CTGAGGGTGAAGGATGAAAAAGG + Intronic
1033086529 7:138347336-138347358 CTGAGGGAGAAGGGGCGGAAGGG - Intergenic
1033173745 7:139107164-139107186 CAGAGGGTGGAGGATAGAAAAGG - Intronic
1033825716 7:145187012-145187034 GAGAGGGTGAGGGGAGGGCAGGG - Intergenic
1033890500 7:146006873-146006895 CACAGGGGAAAGGGTGGGAGTGG + Intergenic
1033970658 7:147034872-147034894 CACAGGATGAAGGGTGTGGAGGG + Intronic
1034037530 7:147840163-147840185 GAAAGGGAGGAGGGTGGGAAGGG + Intronic
1034216235 7:149408366-149408388 CTCAGGGGAAAGGGTGGGAAGGG - Intergenic
1034240347 7:149605954-149605976 CAGAGGTTGAAGGGGAGGGATGG - Intergenic
1034269645 7:149797366-149797388 CAGAGGGTGGAGTGGGGGGACGG + Intergenic
1034838998 7:154378297-154378319 CAGAGGGAGAAGTGAGGAAATGG + Intronic
1035811623 8:2496347-2496369 CAGGGGGACAAGGGAGGGAATGG + Intergenic
1035910699 8:3562766-3562788 TGGAGGGTGGAGGGTGGGAGGGG + Intronic
1037055271 8:14432521-14432543 CTCAGGGTAAAGGGTGAGAAGGG + Intronic
1037168927 8:15866334-15866356 CCCAGGGGAAAGGGTGGGAAGGG + Intergenic
1037292526 8:17366448-17366470 CAGAATGGGAAGGGTGGGAAAGG + Intronic
1037292655 8:17367827-17367849 CAGAATGCGAAGGGTGGGGAAGG - Intronic
1037399681 8:18482643-18482665 CTCAGGGGAAAGGGTGGGAAGGG - Intergenic
1038033031 8:23661445-23661467 CAGAGGGCAAAGGATGGGGAAGG + Intergenic
1038299296 8:26327302-26327324 CTGAGGCTGAAGGGCGGGAAGGG - Intronic
1038324816 8:26564918-26564940 CAGAAGAAGGAGGGTGGGAATGG - Intronic
1038479280 8:27890677-27890699 CAGGGTGGGAGGGGTGGGAAAGG + Intronic
1038610288 8:29054555-29054577 CAGTGGATGAAGGCTGGGGAGGG + Intronic
1038663523 8:29517702-29517724 CAGATGGGGAAGGGTAGGAGTGG + Intergenic
1039666649 8:39540667-39540689 TTGAGGAGGAAGGGTGGGAAGGG - Intergenic
1040719854 8:50306042-50306064 CAGAAGGGGGAGGGTGGGAGGGG - Intronic
1041020387 8:53632739-53632761 CAAAAGGTGAAGGGGGAGAAAGG + Intergenic
1041111204 8:54484377-54484399 TGGAGGGTGAAAGGTGGGAGAGG + Intergenic
1041300645 8:56407786-56407808 CAGAGGGGGAAGGGGTGGAGGGG + Intergenic
1041897602 8:62944001-62944023 AATAGGGGGAAGGGTGGGAGTGG + Intronic
1042043792 8:64624892-64624914 CCCAGGGGGAAGGGTGGGATGGG - Intronic
1042071185 8:64936425-64936447 GAGGTGGGGAAGGGTGGGAAGGG - Intergenic
1042093093 8:65180604-65180626 TGGAGGGTGGAGGGTGGGAAGGG - Intergenic
1042095120 8:65206978-65207000 CTCAGGGGGAAGGGTGGGAAGGG - Intergenic
1042276054 8:67006690-67006712 CAGAGGGACAAGGGAGGAAATGG - Intronic
1042277078 8:67016853-67016875 CAGTGAGGGAAGGTTGGGAAGGG - Intronic
1042433837 8:68741078-68741100 CAGAGGGTGAAGGGAGGGAGGGG + Intronic
1042556977 8:70041857-70041879 CTGGGGGAGAAGGGTGGGAGGGG - Intergenic
1042845812 8:73168517-73168539 CAGATGGTGAAGGCAGGGGAGGG + Intergenic
1042995499 8:74693610-74693632 CGGGGGGGGAGGGGTGGGAATGG + Intronic
1043091319 8:75907927-75907949 CATAGGGTGAGGTGTGGGAAAGG - Intergenic
1043666822 8:82825408-82825430 CTGGGGGTGATGGGTGGGAGGGG + Intergenic
1043681391 8:83029983-83030005 TAGAGGGTGCAAGGTGGGAGAGG + Intergenic
1043935232 8:86135022-86135044 CTGGGGGTGGTGGGTGGGAAAGG + Intronic
1043979475 8:86621634-86621656 CTCAGGGAGAAGGGTGGGAAGGG - Intronic
1044026956 8:87184472-87184494 CAGAGGGTTTGGCGTGGGAAAGG - Intronic
1044224152 8:89700918-89700940 CAGAGGGTGTGGCATGGGAATGG - Intergenic
1044404327 8:91810445-91810467 CAGAGGATGAAGAGTATGAAGGG - Intergenic
1044655761 8:94546709-94546731 CGGAGGGGGAAGGTTGGGACGGG - Intronic
1045691756 8:104766479-104766501 TAGAGGGTGAAAGGAGGGTAAGG + Intronic
1045804404 8:106140437-106140459 CAGAGGGTGAGAGGAGGAAAAGG + Intergenic
1046216761 8:111158141-111158163 CAGAGGGTGAAAGGAGGGAGAGG + Intergenic
1046809330 8:118515708-118515730 CAGAATATGAAGGATGGGAAAGG - Intronic
1047074355 8:121383065-121383087 CAGGAGATGAAGGGTGGAAAGGG - Intergenic
1047096771 8:121634410-121634432 CAGGGGGTGAAGAGAGGGCAAGG - Intronic
1047237484 8:123054834-123054856 CTTGGGGGGAAGGGTGGGAAGGG + Intronic
1047343830 8:124008089-124008111 CGGAGGGGAAAGGGTAGGAAGGG - Intronic
1047367061 8:124221419-124221441 CAGAGGGTGAATGGGGAGGAGGG - Intergenic
1047379543 8:124346114-124346136 CAGAGGGTGAAGGGAAAGCAAGG + Intronic
1047563814 8:126018755-126018777 CAGTGTGTGGAGAGTGGGAAGGG - Intergenic
1047878791 8:129170084-129170106 CACAGGGTGGGGGGTGGGGAGGG - Intergenic
1048007714 8:130432332-130432354 CAGATGGGGAAGGTAGGGAAAGG + Intronic
1048046864 8:130780907-130780929 CAGAGGGAGAAGGGGGACAATGG + Intronic
1048258430 8:132923956-132923978 CAGAGGTGGCAGGGTGGGGATGG + Intronic
1048444315 8:134481851-134481873 CAGAGGGTCTGTGGTGGGAAAGG + Intronic
1048507230 8:135032567-135032589 CAGAGGGTAGAGGGTGGGAAGGG - Intergenic
1048739365 8:137537595-137537617 CAGATGGTGAGGGGTAGGAAAGG + Intergenic
1048885250 8:138904349-138904371 CAGGGGGTGGCGGGTGGTAAGGG - Intronic
1048950517 8:139492875-139492897 CAAAGGTTGATGGGGGGGAAAGG - Intergenic
1049333536 8:142069111-142069133 CAGAGGCCGCAGGGTGGGCAGGG + Intergenic
1049421245 8:142517573-142517595 CAGAGAGCGAGGGGTGGGAGGGG + Intronic
1049429546 8:142553547-142553569 GAGAGTGTGGAGGGAGGGAAAGG - Intergenic
1049473750 8:142787578-142787600 AAGAGGGTGAAGGCGGGGACTGG - Intergenic
1049530334 8:143151420-143151442 CAGGGGGTGCAGCGTCGGAAGGG - Intergenic
1049795790 8:144496775-144496797 CTGAGGGGGAAGGGAGGGCAGGG - Exonic
1050135091 9:2454465-2454487 CTTGGGGTGAAGGGTGGGAGGGG - Intergenic
1050345664 9:4683504-4683526 GTGAGGGACAAGGGTGGGAAAGG + Intronic
1050945282 9:11510016-11510038 CAGAGGGTGAAGGGGAAGCAAGG - Intergenic
1051515153 9:17922525-17922547 GTGAGGGGGAAGGGTGGGAATGG - Intergenic
1051680552 9:19603488-19603510 CACAGGGTGAGGGGAGGGAGGGG + Intronic
1052240054 9:26260968-26260990 CAAAGGGTGAAGGGGGGAATAGG + Intergenic
1052352421 9:27470997-27471019 CAGATGGTTCAGGGTGAGAAGGG - Intronic
1052718633 9:32148219-32148241 TAGAGGGTGGAGGGAGAGAAGGG - Intergenic
1053345972 9:37378508-37378530 CATAGGCTGAAGGGTGGGGCTGG - Intergenic
1054702060 9:68422872-68422894 CACGGGGGAAAGGGTGGGAAGGG - Intronic
1054748346 9:68878895-68878917 CAGGGGGTGAAGGGTTGGAAGGG + Intronic
1054820690 9:69517497-69517519 CTCAGTGTGAGGGGTGGGAACGG - Intronic
1055231906 9:74076647-74076669 CAGAAGGTGAAGGGGAAGAAAGG + Intergenic
1055982117 9:82014386-82014408 CACAGGGTGAAGTCTGGGAGGGG - Intergenic
1056075169 9:83030908-83030930 AAGAGGGAGAAAGGTGGAAAAGG - Intronic
1056138632 9:83653319-83653341 TTGAAGGAGAAGGGTGGGAATGG + Intergenic
1056373226 9:85980138-85980160 CATAGGGTGAAGTATGGGTAAGG + Intronic
1057469285 9:95343355-95343377 TAGAGGGAAAAGGATGGGAAGGG - Intergenic
1057506319 9:95636314-95636336 CCAAGGGTGCAGGGTGGGAAGGG - Intergenic
1057581777 9:96293541-96293563 CAGAGAGAGAAGAGTGGGAGAGG - Intronic
1057608412 9:96518736-96518758 CTGAAGGTGAAGGCTGGGATCGG - Intronic
1057759223 9:97859319-97859341 CAGAGAGGGCAGGGTGGCAAGGG + Intergenic
1057763285 9:97893280-97893302 CAGAGGGTAGAGGGTCTGAAGGG + Intergenic
1057933267 9:99214484-99214506 GAGAGGGTTAAGGTTAGGAATGG + Intergenic
1058102458 9:100932400-100932422 TAGAGGGGGGAGGGTGGGATGGG - Intergenic
1058270133 9:102962082-102962104 CAGAAGGTGGAGGGTAGGAGGGG - Intergenic
1058290692 9:103237357-103237379 CAGAGGGTGGAGGGCGAGAGAGG + Intergenic
1058524003 9:105839143-105839165 CAGAGATTGGAGGGTGTGAAGGG + Intergenic
1058525469 9:105853066-105853088 TAGAGGGTGAGAGGAGGGAAAGG + Intergenic
1058582075 9:106469213-106469235 CAGAGGGGGAAAGGTGAGACAGG - Intergenic
1059048052 9:110892675-110892697 GAGAGGGGGAAGGGAGGGGAGGG + Intronic
1059193657 9:112350216-112350238 CAGAGGGTAAAGGGTGGAATGGG + Intergenic
1059351132 9:113665828-113665850 CAGATGGAGAAGGAAGGGAAAGG - Intergenic
1059422975 9:114204475-114204497 CAGAGGGTCAAGGTTGGTACTGG + Intronic
1059432280 9:114257427-114257449 AAGAGGGCAGAGGGTGGGAACGG - Intronic
1059499771 9:114741641-114741663 CTTAGGGGGAAGAGTGGGAAGGG + Intergenic
1059740521 9:117145373-117145395 CAGAGGGTGAAGGGTGGATCTGG - Intronic
1059890338 9:118795091-118795113 CTGAGAGTGGAGGGTGGGAGAGG - Intergenic
1059990078 9:119856765-119856787 GGAAGGGTGAAGGGTGGAAAGGG - Intergenic
1060180924 9:121533199-121533221 GAGAGGGTGCAGGGTGAGAAAGG + Intergenic
1060915313 9:127385505-127385527 CTGAGGATAGAGGGTGGGAAAGG - Intronic
1061164241 9:128913203-128913225 CAGAGAGTTAAGGGTGGACAGGG + Intronic
1061253710 9:129441286-129441308 CACAGGGTCAAGGGAGGGCAGGG - Intergenic
1061390600 9:130315306-130315328 CAGAGGGAGGAGGGAGGGGAGGG - Intronic
1061480578 9:130896055-130896077 CTTAGGGTGAAGGGTGGGCTTGG - Intergenic
1061625477 9:131838554-131838576 CAGAGGCTGAGGAGTGGGGAAGG - Intergenic
1061925619 9:133804809-133804831 CAGAGGGTTAAGAGTGGGCAGGG - Intronic
1062165441 9:135105200-135105222 CGGAGGAGGAAGGGAGGGAAGGG + Intronic
1062255836 9:135620138-135620160 TAGAGGGGGAAGGGGGAGAAGGG - Intergenic
1062255894 9:135620273-135620295 TAGGGGGAGAAGGGTGAGAAGGG - Intergenic
1062433328 9:136535493-136535515 CAATGGGTGCAGGGTGGGAGTGG + Intronic
1062433405 9:136535703-136535725 CAATGGGTGCAGGGTGGGAGTGG + Intronic
1062433463 9:136535864-136535886 CAATGGGTGCAGGGTGGGAGTGG + Intronic
1062524540 9:136972913-136972935 CACTGGGTGATGGGTGGGCAGGG + Intergenic
1203467480 Un_GL000220v1:100816-100838 GAGGGGGTGTAGGGTGGGGATGG + Intergenic
1185753552 X:2634234-2634256 TAGAGGGTGGAGGGAGGGATAGG - Intergenic
1185871006 X:3664808-3664830 CAAAAGGGGAAGGCTGGGAAGGG + Intronic
1185887282 X:3794049-3794071 CTCAGGGGGAAGGGTGGGAGGGG - Intergenic
1185927538 X:4163927-4163949 CAGAGGCTGAAGGGTGAGGAGGG + Intergenic
1186171609 X:6882945-6882967 CAGAGGGTGTTGGGTAGGATAGG + Intergenic
1186372600 X:8962565-8962587 AAAAGGGAGAAGGGTGGGAAGGG + Intergenic
1186413231 X:9361793-9361815 CAGAAGGTGAAGGGGGAGGAGGG - Intergenic
1186713281 X:12223448-12223470 TTGAGGGTAAAGGGTGGGAAGGG + Intronic
1187134295 X:16531661-16531683 GAAAGGGTGAGGGGTGGCAAGGG + Intergenic
1187265970 X:17733828-17733850 GGGAGGGTGGAGGGTGGGAGAGG + Exonic
1187509812 X:19907587-19907609 CAAAGGGTGGGGGGTGGCAAGGG + Intergenic
1187675280 X:21710396-21710418 CAGAAGGGGAAGGGTGGGAGAGG + Intronic
1187804168 X:23100040-23100062 TAGAAGGTGAAGGGAGGGAGGGG + Intergenic
1188185953 X:27114941-27114963 AAGAGAGGGAAGGGAGGGAAGGG + Intergenic
1188674091 X:32917205-32917227 CAGAAGGTGAAGGGGAGGCAAGG - Intronic
1188863734 X:35288497-35288519 CAGAGGGTGGAGTGTGGGAGGGG + Intergenic
1188877831 X:35453444-35453466 TAGAGGGGGAAGGGAGAGAAAGG - Intergenic
1188991802 X:36830018-36830040 CTCAGGGTGAAGGGTGGGAATGG - Intergenic
1189078861 X:37947467-37947489 CAGAGGGTGAAGGGGAAGCAAGG - Intronic
1189128787 X:38477162-38477184 CACAGGGGAAAGGGTGGGAGGGG - Intronic
1189166759 X:38868151-38868173 CAGGGGGTGAAGGGTGAAAGGGG + Intergenic
1189275301 X:39781044-39781066 GACAGGGTCAGGGGTGGGAAGGG + Intergenic
1189321913 X:40092064-40092086 CGGAGGGAGAAGGGTGGGGCGGG + Intronic
1189682174 X:43527958-43527980 CAGAGGGTTATTGGGGGGAAGGG - Intergenic
1189865590 X:45323805-45323827 AAGAGTGGGAAGGGTGGGGATGG - Intergenic
1190489056 X:50962893-50962915 TTGAGGGTGAAGGGTGGAAGTGG + Intergenic
1190491061 X:50983191-50983213 AAGCGGGGGAAGGGTGGGTACGG - Intergenic
1190596150 X:52053947-52053969 GGGAGGGTGAGGGGAGGGAACGG - Intronic
1190612674 X:52200126-52200148 GGGAGGGTGAGGGGAGGGAACGG + Intronic
1190960070 X:55237546-55237568 CGGAGGGTGAAAGGTAGGAGGGG - Intronic
1191863883 X:65688514-65688536 CACGGGGTGGAGTGTGGGAAGGG + Intronic
1191965621 X:66754015-66754037 CTCAAGGGGAAGGGTGGGAAGGG - Intergenic
1192639216 X:72846908-72846930 AAGAGGGTCAAGGGTGGCACAGG - Exonic
1192642495 X:72873897-72873919 AAGAGGGTCAAGGGTGGCACAGG + Exonic
1192796917 X:74431467-74431489 CAGATGGGGAAGGGTGGGAAGGG + Intronic
1192953669 X:76044824-76044846 AAGTGGGGGAAGGGAGGGAAAGG + Intergenic
1193076541 X:77361696-77361718 CTAAGGGGGAAGGGTGGGAAGGG - Intergenic
1193078535 X:77381932-77381954 CTGGGGGTGAGTGGTGGGAAAGG - Intergenic
1193088017 X:77464897-77464919 CTGAGGGGAAAGGGTGGGAGGGG + Intergenic
1193107215 X:77689762-77689784 CAGTGGTTTAGGGGTGGGAATGG - Intronic
1193278535 X:79620837-79620859 CTGGGGGTGAGGGGTGGGGAGGG - Intergenic
1193333545 X:80261982-80262004 GAGAGAGTGAAGGAGGGGAAAGG - Intergenic
1193503116 X:82304677-82304699 CTCAGGGGGAAGGGTAGGAAAGG + Intergenic
1193795163 X:85865363-85865385 CAGAGGGTGAAGGGGAAGCAAGG - Intronic
1194053794 X:89105072-89105094 CAGAGGGGGAAATGTGGGATTGG - Intergenic
1194058838 X:89171402-89171424 TTCAGGGTGAAGGGTGGGAGAGG + Intergenic
1194089904 X:89572922-89572944 CAGAAGGGGGAGGGTGGGAGGGG - Intergenic
1194094832 X:89626479-89626501 CACAGGGGCAAGGGTGGGAGTGG - Intergenic
1194104124 X:89747338-89747360 CTGAGGGGAAAGGGTGGGAAGGG - Intergenic
1194138208 X:90174433-90174455 AAAAGGGTGTAGGGTGGCAAGGG + Intergenic
1194815673 X:98438545-98438567 CAGAGAGTGGGGGGTGGGGAAGG + Intergenic
1194825503 X:98557762-98557784 CAGAAGGGGAAGGTTGGGAGGGG + Intergenic
1195000857 X:100641957-100641979 CAGAGGCTCCAGGGTGTGAAAGG + Intergenic
1195081837 X:101378478-101378500 CTCAGGGTGAAGGGTGGAAATGG + Intronic
1195259587 X:103118827-103118849 CAGAAGGGGGAGAGTGGGAAGGG - Intergenic
1195264183 X:103164137-103164159 CAGGGGCTGGAGGGTGGGAGGGG + Intergenic
1195412189 X:104579602-104579624 TTGAGGGTGGAGGGTGGGAGAGG + Intronic
1195519865 X:105818675-105818697 CAGAGGGCCCTGGGTGGGAATGG - Intergenic
1195817112 X:108900835-108900857 CTTGGGGGGAAGGGTGGGAAGGG + Intergenic
1196080699 X:111627637-111627659 CGGAGGGTGAGAGGAGGGAAAGG + Intergenic
1196636813 X:118011626-118011648 CTGAGTGTGAAGGATGAGAAAGG + Intronic
1196896383 X:120340930-120340952 CAGGGGGAAAAAGGTGGGAAGGG + Intergenic
1197128786 X:122979569-122979591 CATGGGGGGAAGGGTGGGAGGGG - Intergenic
1197335375 X:125204749-125204771 CTGAGGGTGAGGGGTGGGGTGGG + Intergenic
1197686752 X:129448005-129448027 CAGAGGGGTAGGGGTGGGATGGG - Intronic
1198038324 X:132823422-132823444 CAGAAGGAGGAGGGTGGGAGTGG - Intronic
1198740844 X:139840856-139840878 AAAAGACTGAAGGGTGGGAAGGG + Intronic
1199205583 X:145145189-145145211 GAGAGGGGGTAGGGTAGGAATGG - Intergenic
1199264104 X:145810374-145810396 CTGAAGGTGAAGTCTGGGAATGG - Intergenic
1199293266 X:146129151-146129173 CTCAGGGGGAAGGGTGGGAGGGG - Intergenic
1199315771 X:146376101-146376123 TAGAGAGAGAAGAGTGGGAAAGG + Intergenic
1199408064 X:147485786-147485808 CAGAGGGTTTGGTGTGGGAATGG - Intergenic
1199522298 X:148749865-148749887 CAGTGGGTGAAGGGTAGAAATGG - Intronic
1199613656 X:149638382-149638404 CTCAGGGGGAAGGGTGGGCAGGG - Intergenic
1199758975 X:150890813-150890835 CTGGAGGAGAAGGGTGGGAAAGG + Intronic
1199866896 X:151859792-151859814 CAGAGGGTGGAGGGTGGGAGAGG + Intergenic
1200169422 X:154061547-154061569 CAGAGACTCAAGGGAGGGAAAGG + Intronic
1200172250 X:154085740-154085762 CAGAGGGTGGGGTGGGGGAAAGG + Intronic
1200256611 X:154585882-154585904 CACAGGGGGCAGGGTGGGGAGGG + Intronic
1200261158 X:154618521-154618543 CACAGGGGGCAGGGTGGGGAGGG - Intronic
1200442555 Y:3228976-3228998 CAGAAGGGGGAGGGTGGGAGGGG - Intergenic
1200456079 Y:3395147-3395169 CTGAGCGGAAAGGGTGGGAAGGG - Intergenic
1200484005 Y:3744673-3744695 AAAAGGGTGTAGGGTGGCAAGGG + Intergenic
1200775057 Y:7163081-7163103 CTCAGGGGGAAGGGTGGGAGGGG + Intergenic
1200793082 Y:7316704-7316726 CAAAAGGGGAAGGCTGGGAAGGG - Intergenic
1201386247 Y:13442569-13442591 AAGAGGGTGAGGCATGGGAAAGG - Intronic
1201752776 Y:17451468-17451490 CAGGGGAGAAAGGGTGGGAAGGG + Intergenic