ID: 1129928595

View in Genome Browser
Species Human (GRCh38)
Location 15:79388394-79388416
Sequence TCTCCTTGTCAACAGATTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129928595_1129928597 1 Left 1129928595 15:79388394-79388416 CCCTTAATCTGTTGACAAGGAGA 0: 1
1: 0
2: 1
3: 13
4: 207
Right 1129928597 15:79388418-79388440 TTATGTTTTTTTTTTTAAGACGG 0: 3
1: 44
2: 3745
3: 105425
4: 93261
1129928595_1129928598 2 Left 1129928595 15:79388394-79388416 CCCTTAATCTGTTGACAAGGAGA 0: 1
1: 0
2: 1
3: 13
4: 207
Right 1129928598 15:79388419-79388441 TATGTTTTTTTTTTTAAGACGGG 0: 2
1: 20
2: 1204
3: 20457
4: 34068

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129928595 Original CRISPR TCTCCTTGTCAACAGATTAA GGG (reversed) Intronic
903721790 1:25411179-25411201 TTTCCTTATCAACAGAATAAGGG + Intronic
903868202 1:26413166-26413188 TCTCTTTGTGATCAGATAAATGG - Intronic
904382698 1:30122092-30122114 TGTCCTTGTCATCAAAGTAAAGG - Intergenic
904987725 1:34565662-34565684 TCTCCTGGTCACCAGAGAAAGGG + Intergenic
907584517 1:55605140-55605162 TTTCCTTATCTACAGAATAAAGG - Intergenic
909571232 1:77113632-77113654 TCTCCTTATCATCAGTTTTATGG + Intronic
910261556 1:85298271-85298293 TTTCCTTTTCAACTGTTTAAGGG - Intergenic
911070634 1:93829334-93829356 TTTCCTTGTCACCAGGTTTATGG - Intronic
911773405 1:101776472-101776494 TCTCCTTCTTGACAAATTAAAGG - Intergenic
912232688 1:107814038-107814060 TTTACCTGTCAACAGATAAATGG - Intronic
912341318 1:108918681-108918703 ACTCTTTGTCAACAGACTGAAGG + Exonic
912740857 1:112195886-112195908 ACTCCTAGTCAACAGAGTACTGG + Intergenic
913057244 1:115174048-115174070 TCACCTTGTCAACATAAGAAGGG - Intergenic
915693192 1:157711315-157711337 TCTCATAGTCAACAGAATAGTGG - Intergenic
917021120 1:170588581-170588603 GCTCCTTGTCTACAGATGACAGG + Intergenic
922296818 1:224257241-224257263 GCTGCTTATCAACAGATGAAAGG - Intronic
923936574 1:238767363-238767385 TCTCCTTGAGAACAGAAAAATGG + Intergenic
924735296 1:246750181-246750203 TGTCCTTGTCAAAAGCTAAAGGG - Intronic
1065469004 10:26057192-26057214 TCTCCTTGTCAACTTTTCAAAGG - Intronic
1069586395 10:69606550-69606572 TCACCATATCAACAGACTAAAGG + Intergenic
1071737941 10:88322748-88322770 TCTCCTATTCAACATATTACTGG + Intronic
1073197457 10:101704612-101704634 TCTCCTTCACAACAGATGACAGG + Intergenic
1075195192 10:120350734-120350756 TCTTGTTGGCAACAGATTATTGG - Intergenic
1075448223 10:122528701-122528723 TTTCCTTGTGAACTGAGTAAGGG - Intergenic
1076101439 10:127782660-127782682 TCTCCTAGTCAACATAGTATTGG - Intergenic
1079183121 11:18211282-18211304 TTTCATTGTCAAAAGATGAAGGG + Intronic
1081509404 11:43754069-43754091 TGTCCTTATCAGCAGATCAAAGG + Exonic
1084803508 11:71563260-71563282 AGTGCTTGTCAACAGATGAATGG - Intronic
1085569045 11:77543183-77543205 TCTCCTCTTCTACAGCTTAAAGG - Intronic
1085861485 11:80241192-80241214 TCTCCTTGTTTCCAAATTAATGG + Intergenic
1091098521 11:132846952-132846974 TCTCCTTCTTGACAGATTAATGG + Intronic
1092283899 12:7117659-7117681 TCTCCTTTTCAACAGCTTCTTGG - Intergenic
1092673202 12:10886360-10886382 TCTCCTTGGCAGCAGAGTACAGG + Intronic
1092676528 12:10927171-10927193 TCTCCTTGGCAGCAGAGTACAGG - Intronic
1094765977 12:33594988-33595010 TCTAATTGCCTACAGATTAAGGG - Intergenic
1095333841 12:41002970-41002992 TCTCCTGGTCAACACAGTATTGG - Intronic
1096031790 12:48423775-48423797 TCTCTTTATTAATAGATTAATGG - Intergenic
1097312248 12:58132807-58132829 TGTGCTTGTCTACAGATGAATGG - Intergenic
1099996911 12:89787982-89788004 TACCCTTATGAACAGATTAATGG - Intergenic
1103099159 12:118157272-118157294 TCTCCATGTCACCAGAGTGATGG + Intronic
1104371879 12:128230733-128230755 TCTCCTTGTTAGCTGATTACAGG + Intergenic
1105348308 13:19593781-19593803 TTTCCTTGGCAACATCTTAATGG - Intergenic
1107401168 13:40070718-40070740 TCTCCATGGGAGCAGATTAATGG - Intergenic
1108990532 13:56651245-56651267 ACTCCTATTCAACATATTAATGG + Intergenic
1109634117 13:65091062-65091084 TGACCTTGTGAGCAGATTAATGG + Intergenic
1109857645 13:68154167-68154189 TCACCTTGTAAATAGAATAATGG + Intergenic
1110321345 13:74163330-74163352 TCTGTTTATCAACAGATGAATGG + Intergenic
1114784412 14:25579685-25579707 TCACCTTTTCCACACATTAAAGG + Intergenic
1114960444 14:27881536-27881558 TCTTATAGGCAACAGATTAATGG + Intergenic
1118413854 14:65511803-65511825 TCTTGTAGGCAACAGATTAATGG + Intronic
1119528366 14:75341235-75341257 AGTCCTTGCCAACAGCTTAAGGG - Intergenic
1120629311 14:86870570-86870592 TCTCCTGGTCTCCAGATTACTGG - Intergenic
1124362290 15:29046503-29046525 CCTCCTTGTCAACAAATACAAGG - Intronic
1125712357 15:41797298-41797320 TCTCCTGGTAATCTGATTAAAGG - Intronic
1126124794 15:45285468-45285490 ACTCTTTGTCAACAGAATCAGGG + Intergenic
1127048973 15:55060288-55060310 TCTGCTACTCAAAAGATTAAAGG + Intergenic
1129928595 15:79388394-79388416 TCTCCTTGTCAACAGATTAAGGG - Intronic
1133310872 16:4846403-4846425 ATTCCTTGTCAACAGAAGAATGG - Intronic
1134369667 16:13611387-13611409 TCTCATAATCAAGAGATTAAAGG + Intergenic
1136397273 16:30000157-30000179 TCTCCTTGTCATCAGATCCAAGG - Intronic
1138601466 16:58057384-58057406 TCTCCTTGTCCCCAGATAACAGG + Intergenic
1146021051 17:29279441-29279463 TCTTCTAGTCAACAGAAAAATGG + Intronic
1148705287 17:49625035-49625057 TCTCCTTTTAAACAGATTGCTGG + Intronic
1148918102 17:51001594-51001616 TCTCCTAGTAAACAGAGAAAGGG + Intronic
1154981652 18:21507211-21507233 TCCCCTGGTCTACAGATTATAGG + Intronic
1157539913 18:48493528-48493550 TCTCCATGCCAACATATCAAGGG + Intergenic
1159173635 18:64805932-64805954 TCTGCTTCCCAACAGATAAAGGG - Intergenic
1160372501 18:78385897-78385919 TCACCTTATTAACAGAATAAAGG - Intergenic
1160609395 18:80073671-80073693 TCTGCTTGCCAACAGATTTGAGG + Intronic
1162126403 19:8501950-8501972 TCTCCTTGACCACAGGTGAAAGG - Intronic
1162865857 19:13546424-13546446 TCCCCTTGTCATCTGTTTAAGGG - Intronic
1164417055 19:28055495-28055517 TCTCCTTTTCAACATAGTATTGG + Intergenic
1164566771 19:29331318-29331340 TCTCTTTGTCAACAGAATCAGGG + Intergenic
1165359931 19:35329964-35329986 TCCCCATGTCTAGAGATTAATGG + Intronic
1165922900 19:39309685-39309707 GCTCCTTGTCCAGATATTAAAGG + Intronic
1168342349 19:55632359-55632381 TCTCCTTGTCAACAGCCAGATGG + Intergenic
926512254 2:13796702-13796724 TCTTCTGGGCAACAGATCAAAGG + Intergenic
928664784 2:33539473-33539495 TGTCATTGTCAACAGCTCAAGGG + Intronic
929328878 2:40654202-40654224 TCTCCTTGTGAAGAAATGAAAGG - Intergenic
929610277 2:43265871-43265893 TCTCATTTGGAACAGATTAAGGG + Intronic
930488505 2:52039339-52039361 TCTCCTACACAACAGATTCAAGG + Intergenic
930792767 2:55351712-55351734 TCTGCATGTTAACAGATGAATGG - Intronic
931578622 2:63748501-63748523 TCACCATGTTAACAAATTAAAGG - Intronic
931932097 2:67150108-67150130 ACTTGTAGTCAACAGATTAATGG - Intergenic
932503351 2:72204513-72204535 TCTCTTTGTTTACACATTAAAGG + Intronic
932510600 2:72284590-72284612 ACTCCTTTTCAACATATTATTGG + Intronic
933518109 2:83331713-83331735 CCTTCTTGTCAAAATATTAATGG - Intergenic
934219378 2:90067887-90067909 TCCACTTGTAAGCAGATTAACGG - Intergenic
935661601 2:105471486-105471508 TTTCTTTGTCAACAAATTAAAGG + Intergenic
937723628 2:125132939-125132961 ACTCCTTTTCAACATATTATTGG + Intergenic
939002413 2:136751831-136751853 TCTCCTTTCTAACAGTTTAATGG - Intergenic
939255508 2:139739637-139739659 CATCCTTGACATCAGATTAATGG - Intergenic
939513296 2:143134454-143134476 TCTTCTTTTTAAAAGATTAAAGG + Intronic
940786124 2:157982752-157982774 TCTTGTAGGCAACAGATTAATGG + Intronic
941725214 2:168853159-168853181 TCTCTTAGACAACAGATTCATGG - Intronic
941757565 2:169204008-169204030 AATCCTTGTGAACAGTTTAATGG - Exonic
941827099 2:169911846-169911868 TCTCATTGAAAACAAATTAATGG - Intronic
943782344 2:191838319-191838341 TCTCCTTGTTAACAACTGAATGG + Intronic
945246400 2:207721323-207721345 TTTTCTTGTCAAAATATTAAAGG - Intronic
945291495 2:208131965-208131987 TTTCCTTGTCAAAACATGAAGGG - Intergenic
945563234 2:211364254-211364276 TCTCCTGGTGAAGAGATTCAGGG + Intergenic
946101040 2:217323444-217323466 TATCCTTGTGAACAAAGTAAGGG + Intronic
1168915109 20:1479011-1479033 TCTCCATGTCACCAGTTTATGGG + Intronic
1169952405 20:11059940-11059962 TTTCCTTATCTACAAATTAATGG + Intergenic
1170326690 20:15163042-15163064 TCTCCTTGTAAACAATATAAGGG - Intronic
1171385312 20:24765854-24765876 TCTGCTTGTCAACAGAGTCTGGG - Intergenic
1173033573 20:39386575-39386597 TCACCTTATTAACATATTAAAGG - Intergenic
1173138187 20:40458695-40458717 TCTCCTTCTCCACAGATCAGTGG - Intergenic
1177025117 21:15913271-15913293 ACTCCTATTCAACATATTAATGG - Intergenic
1178455361 21:32744957-32744979 TCTGCTTGACAAAAAATTAAAGG - Intronic
1180918903 22:19508317-19508339 CCTTCTTGTCAACAGCTTTATGG - Intronic
1182237933 22:28891159-28891181 TCTCCTTTCTAACACATTAAAGG - Intronic
949299893 3:2571401-2571423 TCTTCTTTCCCACAGATTAAAGG + Exonic
951982431 3:28580462-28580484 GCTCCTACTCAACAGATAAAAGG - Intergenic
953652040 3:44814945-44814967 GCTCCTTGTCAGCAGAATGAAGG - Exonic
955288314 3:57666739-57666761 TTTCCTTGTCAACAAAATCAAGG + Intronic
959797902 3:110454695-110454717 TCTTCTAGGCAACAGATTAATGG + Intergenic
962204091 3:133420990-133421012 TTTCCTTATCTACACATTAAGGG + Intronic
962562589 3:136622628-136622650 TCTGCTTGTCAAGGGGTTAAGGG - Intronic
963424432 3:145108236-145108258 TATCCATGTCCACAAATTAATGG - Intergenic
964367194 3:155962829-155962851 TCTCATTGTCCACAGAAAAATGG + Intergenic
966492403 3:180542569-180542591 TCTCCCTGTGAACAGATCAAGGG - Intergenic
966927206 3:184652514-184652536 TCTCCCTGTCACCAGACTAATGG + Intronic
967365683 3:188683769-188683791 TCTAATTGTCTACAGATTTATGG + Intronic
967757213 3:193183518-193183540 ACTCCTTTTCAACATATTATCGG + Intergenic
969058878 4:4419458-4419480 ACTCATTGACAACACATTAAGGG + Exonic
971937390 4:33169605-33169627 ACTCTTTGTTAACAGATTATAGG + Intergenic
972237213 4:37148351-37148373 TCTCGTAGGCAACAGATAAATGG + Intergenic
973824668 4:54693212-54693234 TCTCTTTGTAACCAGATTAGGGG + Intronic
974358957 4:60851142-60851164 TCTCTTTATTAACAGCTTAATGG - Intergenic
974400653 4:61401879-61401901 TGACCTCTTCAACAGATTAATGG - Intronic
974867075 4:67594185-67594207 TCTCTTTTTCTACAGATTATGGG + Intronic
975918233 4:79350168-79350190 TCTTGTAGGCAACAGATTAATGG + Intergenic
976010454 4:80481198-80481220 TCTCATTGTCAATAGAGTACTGG - Intronic
977278719 4:95011702-95011724 TTTCCTTGGCAACAGATTCCTGG - Intronic
978261906 4:106769793-106769815 TCTTGTAGGCAACAGATTAATGG - Intergenic
978704254 4:111686898-111686920 TTCCCTTGTCAGTAGATTAAGGG + Intergenic
979267764 4:118723535-118723557 TCTCCTTGTGAACACAACAAAGG + Exonic
979499818 4:121427138-121427160 TCTCCTTGTCATTGGATTTAGGG + Intergenic
983808096 4:172019398-172019420 TCTCATAGGCAACAGATTATTGG - Intronic
983862536 4:172725461-172725483 TCTTCTTCTCAACAGATATAAGG + Intronic
984355210 4:178650006-178650028 TCTTGTAGTCAACAGATTATTGG + Intergenic
984393312 4:179166425-179166447 TCTTTTTGTCAACAGCTTTAAGG + Intergenic
986147606 5:5093739-5093761 TTTCTTTGTCAACAGATGATGGG + Intergenic
987576021 5:19729903-19729925 TTTCCTTATCAACAGAATAAGGG + Intronic
989457601 5:41661453-41661475 TTTCCTTGTCAACTGATCACAGG + Intergenic
989980487 5:50637804-50637826 TCTAGTTGTCAACAGATTCAGGG - Intergenic
990771859 5:59256128-59256150 TATACTTGTCAACAAATTTAAGG - Intronic
993948584 5:94145427-94145449 TCTTGTAGGCAACAGATTAATGG - Intergenic
994475712 5:100266359-100266381 TCTGCTTGTCAACAGCCAAATGG + Intergenic
995110648 5:108424875-108424897 ACTCCTTTTCAACAGAGTATTGG - Intergenic
995145143 5:108779815-108779837 TCTCCTTCTCAACATCTTACTGG - Intronic
995290973 5:110453203-110453225 TCTCTTTGGTAACAGATTACAGG - Intronic
995521031 5:113005754-113005776 TATGCCTGTCAACAGATGAATGG + Intronic
995902660 5:117088511-117088533 TTTCCATGTCAACAATTTAAAGG - Intergenic
996643159 5:125782184-125782206 TATGCTTTTCAAAAGATTAATGG - Intergenic
997109472 5:131059056-131059078 TTTCCTTATCAAGAGATAAAGGG + Intergenic
997562326 5:134858262-134858284 TCTCCCTGTGAACAGTTTACCGG + Exonic
998478464 5:142441430-142441452 TCACCTTATCCACAGAATAAAGG - Intergenic
1000447020 5:161334517-161334539 TCTCATTATCAACAGATATACGG + Intronic
1003126765 6:3362037-3362059 TGTGCTTGTCAGCAAATTAAAGG + Intronic
1005611346 6:27528444-27528466 TATGTTTGTCAATAGATTAATGG - Intergenic
1007187368 6:39983770-39983792 TCTCCATGGCAACAAATAAAGGG - Intergenic
1008250091 6:49229242-49229264 TCTTGTAGGCAACAGATTAAAGG + Intergenic
1011243037 6:85292896-85292918 ATTCCTTGTCATCAGAATAATGG + Intergenic
1011701042 6:89955114-89955136 TTTCCTTATCTACAGAATAAGGG - Intronic
1012127175 6:95444688-95444710 TCTACTTTTCAAAAGAATAATGG - Intergenic
1012703745 6:102495743-102495765 TCTCCTTATCAACCTATTTATGG + Intergenic
1013924132 6:115447706-115447728 TCTCCTTCTCCAGAGGTTAATGG + Intergenic
1014509306 6:122301263-122301285 TTTCCTTGTAAACTAATTAAAGG + Intergenic
1016011328 6:139140024-139140046 TCTACTTGTCAACAGATATATGG - Intronic
1016228254 6:141769474-141769496 TCTTCTAGGCAACAGATTATTGG + Intergenic
1017736163 6:157366666-157366688 TGTCCTTATCAGCAGATTACAGG - Intergenic
1018189467 6:161296891-161296913 TCTCCTCTTCATCAGAATAAAGG + Intergenic
1020813073 7:12869979-12870001 TCTCCATGGCAACACATGAAAGG + Intergenic
1021774862 7:24043142-24043164 TTTCCTTGACATCAGAATAATGG - Intergenic
1023768128 7:43530954-43530976 TCTCATCGTCTACAGTTTAAAGG + Intronic
1024928419 7:54642883-54642905 TATTTTTGACAACAGATTAAAGG - Intergenic
1025766154 7:64453196-64453218 TCTGCTTGTCCAGAGATTGAAGG - Intergenic
1030834927 7:114271305-114271327 ACTCCTTCTCAACAGTTTATTGG - Intronic
1031666750 7:124493843-124493865 TTCTCTTATCAACAGATTAATGG - Intergenic
1035841519 8:2816729-2816751 TCACCATGTTAACAGAGTAAAGG - Intergenic
1036250164 8:7155295-7155317 TCTCCTTTACAACAAATGAAAGG - Intergenic
1036367324 8:8132155-8132177 TCTCCTTTACAACAAATGAAAGG + Intergenic
1036883558 8:12533507-12533529 TCTCCTTTACAACAAATGAAAGG - Intergenic
1036987841 8:13556557-13556579 TCTCCTTTTCAAGAGATTCTGGG + Intergenic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1038296657 8:26298067-26298089 ACTCCTTTCCAACAGCTTAAGGG - Intronic
1039578939 8:38648241-38648263 TCTCATTTTCAGCAGACTAATGG + Intergenic
1040711568 8:50195305-50195327 TCTCCTTGGAAACAGACTCAGGG - Intronic
1041327795 8:56687700-56687722 TCTCCTTGCAAACAGAGTAATGG + Intergenic
1042102231 8:65285909-65285931 TCTCTTTGAAAACAAATTAAGGG - Intergenic
1043823473 8:84896686-84896708 TCTCCTTGTCCCCACATTCAGGG - Intronic
1044499504 8:92936340-92936362 TATTCTTGTTAACTGATTAAAGG + Intronic
1046151769 8:110236278-110236300 GCTTATTGTCAACAGAATAAAGG + Intergenic
1046310819 8:112434709-112434731 TATCCTTGTGAACACATTGATGG - Intronic
1048102264 8:131366112-131366134 TTTCCTTCTGAACAAATTAAAGG - Intergenic
1048183647 8:132218889-132218911 TCTCCTTGGCCACAGAGGAATGG + Intronic
1048811828 8:138295357-138295379 TCTCCTTATCTACAGAATATGGG + Intronic
1049782303 8:144434607-144434629 TCTCCCTGTCAGCAGATCATGGG + Intronic
1052384968 9:27811741-27811763 ACTCCTAGTCAACATATTATTGG + Intergenic
1056007588 9:82288887-82288909 TCTTGTAGGCAACAGATTAAAGG - Intergenic
1056466745 9:86864056-86864078 TCTCCTTGTGCACAGATGCAAGG - Intergenic
1058698818 9:107584304-107584326 TCTCATTGTCCTCAAATTAAAGG + Intergenic
1059008536 9:110430898-110430920 TCTCCCTATCTACAGATTCAGGG + Intronic
1059855143 9:118388168-118388190 TGTTTTTGCCAACAGATTAAAGG - Intergenic
1186595803 X:10980334-10980356 TTTCCTTGTCCAGAGATTCAGGG - Intergenic
1186613652 X:11163902-11163924 GCTCCATGGCAACAGGTTAAAGG + Intronic
1187660018 X:21534324-21534346 TGTGTTTATCAACAGATTAATGG - Intronic
1188846060 X:35073961-35073983 TCTCATAGGCAACAGATGAAAGG + Intergenic
1189657731 X:43264384-43264406 TCTCGCAGGCAACAGATTAATGG + Intergenic
1192722641 X:73715871-73715893 CCTGCTTGTCAACTGATTATTGG - Intergenic
1192971150 X:76232169-76232191 TCTTTTTGTCAACAGATGATAGG - Intergenic
1193675887 X:84452130-84452152 TCTCCTAGTCAACATAGTAATGG + Intronic
1194714340 X:97273186-97273208 TATCCTTGTCAACAATATAATGG + Intronic
1195132390 X:101866204-101866226 TCTTCTAGGCAACAGATCAATGG - Intergenic
1195674525 X:107497782-107497804 TCTCCTAGTGAACAGATTAATGG - Intergenic
1196641151 X:118062857-118062879 TTTCCTTTTCACCAGATTCAGGG - Intronic
1199365998 X:146983946-146983968 TCTCCTTGTAAACATATGTAAGG + Intergenic
1199369644 X:147032396-147032418 TCCCCATTTAAACAGATTAATGG + Intergenic
1199591691 X:149473655-149473677 TCTGCTTGTCCACATAGTAATGG + Intergenic
1200485481 Y:3764062-3764084 ACTCCTATTCAACAGATTATTGG - Intergenic