ID: 1129928966

View in Genome Browser
Species Human (GRCh38)
Location 15:79392956-79392978
Sequence TGGGGATCCCTGAAGCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 262}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129928966 Original CRISPR TGGGGATCCCTGAAGCCAGA AGG (reversed) Intronic
900093887 1:932571-932593 TGGTGGTCCCTGAACCCACACGG + Intronic
900407892 1:2500429-2500451 TGGGGAGCCCTGCAGCCTGGGGG - Intronic
900555618 1:3278943-3278965 TGGAGATCCGTGGAGCCACACGG + Intronic
901794609 1:11673123-11673145 TAGGGAGCGCTGAAGCCAGCTGG + Intronic
901800797 1:11706820-11706842 GGGGTCTCACTGAAGCCAGAGGG + Intronic
902862792 1:19257988-19258010 TGGGCAGCCCTGGAGCCAAAAGG + Intronic
903601871 1:24547904-24547926 TGCCCATCCCTGAGGCCAGATGG + Intergenic
903777491 1:25801891-25801913 TGCAGGACCCTGAAGCCAGATGG - Intronic
904312138 1:29635725-29635747 TGGTGGTCCATGAAGCCTGAGGG - Intergenic
904481717 1:30798010-30798032 TGGGGAGCCCTGGAGGCAGGAGG + Intergenic
905107277 1:35571769-35571791 TGGGTATCCCAGAAGGCACATGG - Intergenic
905244618 1:36603882-36603904 AGGGGAGCCTTGAACCCAGATGG + Intergenic
905539697 1:38750213-38750235 CAGGGATCCCTGAACACAGAAGG + Intergenic
905661283 1:39728046-39728068 TGGGGAACCCAGAAGAGAGATGG + Intronic
906097579 1:43234717-43234739 TGGGGAGCCCTGAAGACAGGTGG - Intronic
907304773 1:53507394-53507416 CAGGTATCTCTGAAGCCAGATGG - Intronic
908305885 1:62815618-62815640 TGAGGATCACTGGAGCCAGGAGG - Intronic
910109310 1:83665572-83665594 TGGTGATTCTTGAAGCCAGAGGG + Intergenic
910907953 1:92201546-92201568 TGGGGATGGATGGAGCCAGATGG - Intergenic
911154713 1:94626307-94626329 TGGAGATTTCTGAAGGCAGAAGG + Intergenic
911537306 1:99115882-99115904 TGACGATCTCTCAAGCCAGAGGG - Intergenic
913136361 1:115893258-115893280 TGGGGCTCCCTGACACCTGATGG + Intergenic
914924662 1:151873811-151873833 TGAGGCTCCCAGAAGCCAGGAGG + Exonic
915849642 1:159307547-159307569 TGGTGCTCCCTGGAGCCACAGGG - Intronic
916079468 1:161223449-161223471 TGGGGGACACTGAAGCCAAATGG + Intronic
918121042 1:181540651-181540673 TCGTGATCCCTGAAGACAGAGGG + Intronic
920213883 1:204348671-204348693 TGGGAGTGCCTGAAGCAAGAGGG - Intronic
921275104 1:213511476-213511498 TGGAGTTCCCTGAAGCAAGTGGG + Intergenic
922384941 1:225073267-225073289 TGGGGCTCTCTAAAGCCCGAAGG + Intronic
1063490354 10:6458334-6458356 TGAGGACCCCTGGAGCCAGCTGG + Intronic
1064682295 10:17822881-17822903 CGAGGATCCCTGAAGCTGGAAGG - Intronic
1065195259 10:23258113-23258135 TGGGGATGCCAGAGGCCACATGG - Intergenic
1067053326 10:43037616-43037638 GGGGGTTCCCAGAGGCCAGAGGG + Intergenic
1068272455 10:54746700-54746722 TGGGGAACCCTGACACAAGAAGG - Intronic
1069944475 10:71976362-71976384 GGGGGACCCCTGAAGACAGCAGG - Intronic
1070719195 10:78744773-78744795 TGGGGAGCGCTGAAGCAGGATGG + Intergenic
1073248258 10:102106689-102106711 GGGGGACCCCAGAATCCAGAGGG + Intergenic
1073255239 10:102146770-102146792 GAGGGAACCCTGAAGCCTGAAGG + Exonic
1074288982 10:112124162-112124184 TGGGGATCCCTCCAGCAACAGGG - Intergenic
1075427462 10:122352957-122352979 AAGGGTGCCCTGAAGCCAGATGG - Intergenic
1075645414 10:124093150-124093172 TGGGGATCGCTGAAGCCTCGGGG + Intronic
1076211980 10:128656375-128656397 TGGAGATCCCTGAAACAAAATGG - Intergenic
1076405958 10:130212687-130212709 TGGGGACCCCTGCCTCCAGACGG + Intergenic
1076424003 10:130354584-130354606 TTTGGATCCTTGATGCCAGAAGG + Intergenic
1076791181 10:132777647-132777669 TGGGGAGACATGAAGGCAGAGGG - Intronic
1077128583 11:957235-957257 TGGGGATCCCTGGAGGGACATGG - Intronic
1077336514 11:2007287-2007309 TGGAGCCCCCAGAAGCCAGAAGG - Intergenic
1077576408 11:3387051-3387073 TGGGGGTCCTAGAAGCCAGGGGG + Intergenic
1077635452 11:3838919-3838941 TAAGGATGCCTGAAGGCAGAGGG + Intronic
1078088548 11:8249288-8249310 TGGGGCCGTCTGAAGCCAGAGGG + Intronic
1078467114 11:11558639-11558661 TGGGAGCCCCTGCAGCCAGAGGG + Intronic
1079493291 11:21012931-21012953 TCAGGATTCATGAAGCCAGAGGG - Intronic
1080250234 11:30225747-30225769 TGGGGTTCCCAGAAGCCAGAAGG + Intergenic
1080414008 11:32052834-32052856 TGGGGAGCGCTGAAGGCAAAAGG + Intronic
1081748217 11:45487952-45487974 TGGGGATCCCAGAGGCTAAAGGG - Intergenic
1082831854 11:57624193-57624215 TGCTGCTCCCTGAAGCCAGCCGG - Intergenic
1083325172 11:61869433-61869455 TGGGGATACTGGAGGCCAGATGG + Intergenic
1083889510 11:65588926-65588948 TGGGGAGCCCTGAGGACAGAAGG + Intronic
1084150793 11:67287061-67287083 TAGGGGTCCCTGAGGCCTGAGGG + Intergenic
1084162145 11:67355721-67355743 TGGGGGTAGCTGAAGCCTGAGGG - Intronic
1085038377 11:73312870-73312892 CAGGGATAGCTGAAGCCAGAAGG - Intronic
1086528032 11:87752057-87752079 TTGTGATGGCTGAAGCCAGAAGG - Intergenic
1088757916 11:112901976-112901998 AGGGGGTCTCTGAAGCCTGAAGG + Intergenic
1088914599 11:114217922-114217944 TGGGGATCCCTGCAGATAGATGG + Intronic
1089079117 11:115761363-115761385 GGGGGATCCTTGAGGTCAGATGG + Intergenic
1089523957 11:119084596-119084618 GGGGGATCGCTGAAGCCGGGAGG + Intergenic
1090641980 11:128737630-128737652 TGGGGTACCCTGAGGCAAGAGGG - Intronic
1202819498 11_KI270721v1_random:62469-62491 TGGAGCCCCCAGAAGCCAGAAGG - Intergenic
1091673139 12:2467308-2467330 AGAGGAGCCCTGAGGCCAGAGGG + Intronic
1092537977 12:9404667-9404689 TGGGGGTCCCAAAAGCCAGTGGG - Intergenic
1092556928 12:9569385-9569407 TGGGGGTCCCAAGAGCCAGAGGG + Intergenic
1093847534 12:23991270-23991292 GGAGGATCCCTAAAGCCAGGAGG + Intergenic
1094514009 12:31117657-31117679 TGGGGGTCCCAGGAGCCAGGGGG - Intergenic
1094514482 12:31119212-31119234 TGGGGGTCCCTAGAGCCAGGGGG - Intergenic
1094514813 12:31120242-31120264 TGGGGGTCCCTAGAGCCAGGGGG - Intergenic
1095269700 12:40203515-40203537 GGAGGATCCTTGAACCCAGAAGG - Intronic
1096704906 12:53414371-53414393 TGGAAATCCCTGAAGGAAGACGG - Intronic
1098382304 12:69881846-69881868 TGGGGATCCCTGAAGAAATTAGG - Intronic
1099104606 12:78483118-78483140 TGGGGATCTCCAAAGCCAAAAGG + Intergenic
1101676700 12:106923720-106923742 TGGGGAGGCCTCAAGGCAGAAGG + Intergenic
1103329531 12:120144511-120144533 TGGGGCTCACTGAAGGCTGAGGG + Intronic
1103451374 12:121031647-121031669 TGGGGATTGAGGAAGCCAGAGGG + Intronic
1103917696 12:124384460-124384482 GGGGCCTCCCTGAGGCCAGAGGG + Intronic
1104102348 12:125624536-125624558 TGGGGATTCCTCAAGCCCCAAGG + Intronic
1104127865 12:125864594-125864616 GTGGGTTCCCAGAAGCCAGATGG - Intergenic
1105686354 13:22786161-22786183 AGGAGATCCCTGAAATCAGAAGG + Intergenic
1106575161 13:30967662-30967684 AGGGGATCCCTGGAGCTGGAAGG + Intronic
1107013085 13:35686742-35686764 TTGGGGCTCCTGAAGCCAGAAGG - Intergenic
1107796537 13:44058689-44058711 TTGGGTTCCACGAAGCCAGATGG - Intergenic
1109380744 13:61556919-61556941 AGAGGATCACTGAGGCCAGAAGG + Intergenic
1109711387 13:66165164-66165186 TGGGGAAGCCAGAAGCCAGTGGG + Intergenic
1111549222 13:89784726-89784748 GTGGGCTCCGTGAAGCCAGAGGG - Intergenic
1112026613 13:95417315-95417337 TGGGGATCCCTGAAAGTAGTTGG - Intergenic
1112172477 13:96988644-96988666 GGCTGAGCCCTGAAGCCAGATGG + Intronic
1113619166 13:111701334-111701356 TGGGGGTCCCTGAGGACGGAAGG + Intergenic
1113624695 13:111786595-111786617 TGGGGGTCCCTGAGGACGGAAGG + Intergenic
1115006139 14:28487526-28487548 TTAGGATCTCTGAAGCAAGATGG + Intergenic
1115689474 14:35827875-35827897 TGGGTATCCCTGCAGGGAGAGGG + Intronic
1117292214 14:54344789-54344811 TGAGGACCCCAGAGGCCAGACGG - Intergenic
1119021909 14:71123569-71123591 TGGGGAGGCCTGGAGCTAGATGG + Intergenic
1122969365 14:105146254-105146276 TGGGTGTCCCTGAGGGCAGACGG + Intronic
1123479733 15:20620026-20620048 TGGTGCTCCCTGAATCCACATGG + Intergenic
1123638273 15:22380338-22380360 TGGTGCTCCCTGAATCCACATGG - Intergenic
1123990957 15:25683006-25683028 AGGGGATCACTGAAGCTAGAGGG - Intronic
1125974334 15:43937769-43937791 TGGGGAGATCTGGAGCCAGAGGG + Intronic
1127372607 15:58355252-58355274 GGAGGATCCTTGAAGGCAGATGG - Intronic
1128982896 15:72199378-72199400 TGGAGGCCCCTGGAGCCAGATGG - Exonic
1129928966 15:79392956-79392978 TGGGGATCCCTGAAGCCAGAAGG - Intronic
1130580904 15:85135976-85135998 TGGGGATGCTTCAAGCCAGGTGG + Intronic
1132345336 15:101104790-101104812 GGGGTTTACCTGAAGCCAGATGG + Intergenic
1132410816 15:101577141-101577163 TGGGGTTCCCTGCCTCCAGAAGG - Intergenic
1132934238 16:2472922-2472944 TGGGGATCTGGGAAGTCAGAGGG - Intronic
1134095739 16:11417314-11417336 AGGGGATTACTGGAGCCAGAAGG - Intronic
1135288096 16:21211343-21211365 TGGAGTTCCCTGAAGTCACAAGG + Exonic
1135702347 16:24643278-24643300 TGGGGATTCCTGATGACAAAAGG - Intergenic
1135921003 16:26648979-26649001 TGGGGACCCCAGGAGGCAGACGG - Intergenic
1137379042 16:47980944-47980966 TGTGGCTCCCTGTAGCTAGAAGG - Intergenic
1142214069 16:88822295-88822317 TGGGGATGGCTGAGGCCAGAGGG - Intronic
1143018408 17:3904016-3904038 TGCGGATGCCTGGAGCCAGAGGG + Exonic
1143023003 17:3926282-3926304 TGGGGCCTCCTAAAGCCAGACGG - Intronic
1143220079 17:5254524-5254546 TGGAGAACTCAGAAGCCAGACGG + Intergenic
1143479129 17:7218605-7218627 TGGGGGTGCCAGGAGCCAGAGGG + Exonic
1144813675 17:18018477-18018499 TGGGGAGCCCTGAAGGCCGGGGG + Exonic
1144841585 17:18189884-18189906 TGGGGCTTTCTGAATCCAGAGGG - Intronic
1146477334 17:33173454-33173476 TGGGGATCGGTGAAGGCAGGAGG + Intronic
1147657286 17:42098180-42098202 TGGTTATCCCTGATGCCAGGCGG - Intergenic
1151759332 17:76091632-76091654 GGGGGCACCCTGAAGCCAGCAGG + Intronic
1151994209 17:77598299-77598321 TGGGCATGACTGAAGGCAGAAGG + Intergenic
1152544461 17:80993755-80993777 TGGGTGTCCCTGCAGCCGGATGG + Intronic
1152817342 17:82415803-82415825 TGGAGATCCCTGAAGGGAAAGGG - Intronic
1153895285 18:9553598-9553620 TGGTGATTCCTGAAGGCAAATGG - Intronic
1155646255 18:28081668-28081690 TGGACAGTCCTGAAGCCAGATGG - Intronic
1159421357 18:68224693-68224715 TGGGTGTCCCTGAGGCTAGAGGG - Intergenic
1160528214 18:79549367-79549389 TGGGGATGCTTGACTCCAGAGGG + Intergenic
1160875033 19:1292954-1292976 TGGGGAACCAAGAGGCCAGAGGG + Intronic
1163338306 19:16687984-16688006 TGGGGGTGCATGCAGCCAGAGGG + Intronic
1163515820 19:17762952-17762974 TGGGGATTCCAGGAACCAGAGGG + Intronic
1164881097 19:31733654-31733676 TGGGCATCCCTGAAGCCCCAGGG + Intergenic
1165799283 19:38537703-38537725 TGGGCATCCATGACGCCAGGCGG - Intronic
1166916453 19:46198859-46198881 AGGGGCTCCTTGAGGCCAGATGG + Intergenic
1167749616 19:51371872-51371894 TTGGGGTCCCTGAGGACAGAGGG - Intronic
925372373 2:3356109-3356131 TGGGGAGCTCTGGAGCCGGACGG + Intronic
925899695 2:8500031-8500053 TGGGGAAACCAGAAGCCAGCTGG - Intergenic
926340654 2:11901984-11902006 AGGGGATCCAGGAAGCCAAATGG - Intergenic
927246912 2:20964256-20964278 TGGGGATTCTTGAAGTCAGAAGG - Intergenic
929574155 2:43041752-43041774 TGGGGGCTCCTGAAGACAGAGGG - Intergenic
930028324 2:47043342-47043364 TGGGGATACAGAAAGCCAGAGGG + Intronic
930197538 2:48524345-48524367 TGAGAATCCTTGAACCCAGAAGG - Intergenic
932219122 2:69986650-69986672 TGGGGACCCTTTAATCCAGATGG + Intergenic
932306175 2:70705555-70705577 TGTGGACCACTGAAGGCAGAGGG - Intronic
932352486 2:71043661-71043683 TGGGGATCCCAAGAGCCAGGGGG - Intergenic
933417347 2:82002965-82002987 AGGAGATACCTGTAGCCAGAAGG - Intergenic
933656728 2:84894643-84894665 TTGGGATCCCTTAAGCAAAAAGG - Intronic
935730635 2:106062393-106062415 TGGGGAGCTCAGAGGCCAGAGGG + Intergenic
936016391 2:108962168-108962190 TAGGGTTCCCTGATGGCAGATGG + Intronic
936095492 2:109527963-109527985 TGGAGACCCCTGCAGCCAGGCGG + Intergenic
936235543 2:110739588-110739610 TGGGGAACACTGGAGCCAGTAGG - Intronic
936239739 2:110777211-110777233 TGGGGATCCCTCCAGCCTTATGG - Intronic
937096694 2:119240367-119240389 TGTGGCACCCTGCAGCCAGATGG - Intronic
937098963 2:119254115-119254137 TGGGGCTCCAGGAAGACAGAGGG + Intronic
937118039 2:119423057-119423079 TGGGGAAGGCTGATGCCAGAGGG + Intergenic
937296167 2:120811178-120811200 TCCGCCTCCCTGAAGCCAGATGG + Intronic
938382380 2:130843843-130843865 AGGGGGGCCCTGAATCCAGAGGG + Intronic
940874384 2:158885200-158885222 GTGGTAACCCTGAAGCCAGATGG + Intergenic
945247562 2:207733106-207733128 AAGGGATCCCAGAAGGCAGATGG + Intronic
946188807 2:217996422-217996444 TGGGACTCCCAGAAGCCAGCCGG - Intronic
947669816 2:231929111-231929133 TGAGCATCCCTGAAGCCTGCAGG + Intergenic
1171410181 20:24941439-24941461 TGGTATTCCCTGAAGCCACAAGG - Intergenic
1175108438 20:56630092-56630114 TGGGGGTGCCCGAGGCCAGATGG + Intronic
1175611791 20:60357839-60357861 TGGGGCTCCCTTCAGCCAGGAGG - Intergenic
1176016256 20:62934824-62934846 AGGCGCTCCCTGAAGCCACAGGG - Intronic
1176108448 20:63400267-63400289 TGGGGATCCCTGCTGCCACGGGG - Intergenic
1176171243 20:63697314-63697336 TGGGGGTGCCTGCAGCCAGGAGG - Exonic
1176882900 21:14218535-14218557 AGGTGGTCCTTGAAGCCAGAAGG + Intronic
1177320317 21:19512574-19512596 TCAGGATCCCTGAAGGCAGCAGG + Intergenic
1178188400 21:30251572-30251594 TGGGGTCCCCTGAAGAAAGAGGG - Intergenic
1182153133 22:28044733-28044755 TCTGGATCCCAGAGGCCAGAAGG - Intronic
1182519973 22:30879644-30879666 TGGGGACCCATGGAGCCACAAGG - Intronic
1182833713 22:33324374-33324396 TGGGGAGCCATGGAGCCGGAGGG + Intronic
1184105516 22:42365510-42365532 TGGGGACCCCTGGAGCCTGGGGG + Intergenic
1184148618 22:42625789-42625811 AGAGGATCCCTGAGGCCAAATGG + Intronic
1184152536 22:42647116-42647138 TGGGGAGCCCGTAAGCCAGGAGG + Intronic
1184724804 22:46337616-46337638 ACCGGATCCCTGAAGCCACATGG + Intronic
950106397 3:10391719-10391741 TGGGGATACCGGAGGACAGAGGG - Intronic
950398953 3:12755733-12755755 TGGGGCTCCCAGAGGCCAGTGGG + Intronic
950484353 3:13264318-13264340 TGGGCATCACGGCAGCCAGATGG - Intergenic
951052695 3:18112174-18112196 TCCCGAGCCCTGAAGCCAGATGG + Intronic
953045184 3:39288602-39288624 AGGGGAGCTCTGAAGCCAAAGGG - Intergenic
953582727 3:44171934-44171956 TGAAGCTCCCAGAAGCCAGAGGG - Intergenic
953900241 3:46836278-46836300 GGAGGATCCCTTAAGCCCGAGGG + Intergenic
953964640 3:47294497-47294519 TGAGGATATCTGAAGGCAGAGGG + Intronic
954390866 3:50267395-50267417 TGGCGGTCCCAGAAGCCAGGTGG - Intergenic
954413638 3:50382240-50382262 TGGGGGTCCCTGAAGGAGGAAGG - Intronic
954697454 3:52435357-52435379 TGGGGCTGCCAGCAGCCAGAGGG + Exonic
954699897 3:52445676-52445698 TGGGGTGCCTGGAAGCCAGATGG - Intergenic
954777264 3:53031087-53031109 TTGGGATCCCTGAAACCAGGAGG - Intronic
954784637 3:53083858-53083880 TGGGGATCTCAGAAGCCATGTGG + Intronic
954976236 3:54697595-54697617 TGGGGCACCTTGCAGCCAGAGGG - Intronic
955148281 3:56341789-56341811 TGGTGATCCCTGAAAACACAGGG + Intronic
955608169 3:60729194-60729216 TCTGGATTTCTGAAGCCAGAAGG - Intronic
960051152 3:113240829-113240851 TGGGGATCCCTGAGGTCTAAGGG - Intronic
960082218 3:113553714-113553736 TGGGGAAGTCTAAAGCCAGAGGG + Intronic
962710297 3:138080612-138080634 TGTGGATCCCTGAAGAGAGGAGG + Exonic
963286451 3:143438737-143438759 TGGGGATTGCTCAAGCCACATGG + Intronic
963880057 3:150519018-150519040 TGGCATTCCCTGAAGCCACAAGG - Intergenic
964427059 3:156565059-156565081 CTGAGATCCCTGAAGACAGAGGG + Intergenic
964814731 3:160704600-160704622 TGGGGTTCCCTGATGTCAGTGGG + Intergenic
968815832 4:2821201-2821223 TGGGTATCTCTCAAGCCTGAGGG - Intronic
969468550 4:7372145-7372167 TGGGCACCCCAGAAGCCAGAAGG + Intronic
969788311 4:9474851-9474873 TGGGGGTCCCAGGAGCCAGGGGG - Intergenic
969788372 4:9475021-9475043 TGGGGATCCCAAGAGCCAGGGGG - Intergenic
972305691 4:37827321-37827343 GGGGGACTCCTGAAGCCAGGCGG - Intronic
974069253 4:57109742-57109764 CGGGCATCCCAGGAGCCAGATGG - Intronic
975437090 4:74365387-74365409 TGGGGCGGCCGGAAGCCAGAGGG - Intronic
976694110 4:87899933-87899955 TGGGGATCACTGAAGTCTGTAGG + Intergenic
979452919 4:120893328-120893350 TGGGGATCCATCAAGGCAGCAGG - Intronic
981315802 4:143337996-143338018 AGGGGACAGCTGAAGCCAGAAGG + Intronic
983656081 4:170086344-170086366 TGGAGTTCCCGGAACCCAGAAGG + Intronic
984426783 4:179597530-179597552 TAGGAATGCCTGCAGCCAGAAGG + Intergenic
987823675 5:22999682-22999704 TGGGAATCCCTGGAGCCACATGG + Intergenic
989047574 5:37287704-37287726 TGGGGATCCCGGATCCCACATGG + Intergenic
989553016 5:42757430-42757452 TGGGGATGGTTGAAGCCAGCAGG + Intronic
990308292 5:54515310-54515332 TGGAGATACCGGAAGACAGAGGG - Intergenic
990330210 5:54718564-54718586 GGGGGGTCCCTGGAGCCACATGG - Intergenic
991489217 5:67166414-67166436 AGGGCTTCCCTGAGGCCAGAGGG + Exonic
992140960 5:73796477-73796499 TGGGGCTCCCTGGAGGCTGAGGG + Intronic
993947306 5:94131130-94131152 TGGTTATCACTGAAGCCAAATGG - Intergenic
997440559 5:133905979-133906001 GGGGGATCACTAAAGTCAGAGGG + Intergenic
997471436 5:134119592-134119614 TGGGGATGCCCCAAGCCAGGGGG + Intronic
997585464 5:135040589-135040611 TGGGGAGCCCTGTGGCCTGAGGG - Intronic
998202578 5:140136870-140136892 TGCTGTTGCCTGAAGCCAGAAGG - Intergenic
999124851 5:149239488-149239510 CAGGGATCCCAGAAGCCTGAGGG - Intronic
999409979 5:151342289-151342311 TGAAGGTCCCTGAAGCAAGAAGG - Intronic
999550285 5:152679033-152679055 TGTGGACTCCTGAAGCCAGATGG + Intergenic
1002270856 5:178070979-178071001 TGGGGTTCCCTGAATCCATCTGG + Intergenic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1006054231 6:31369274-31369296 TGGGGCTCCCTGTAACCAGGTGG + Intergenic
1006473880 6:34243124-34243146 TGGGGTTCCCTGGAGCCTGAAGG + Intronic
1006967537 6:38003844-38003866 AGGGGTTCCCTGAAGGCAGAAGG - Intronic
1006982759 6:38159073-38159095 TGGGAGTCCCAGAAGCCAGGCGG + Intergenic
1007776233 6:44225984-44226006 TGGGGCCCCATGAAGCCTGAGGG + Intronic
1008981684 6:57490727-57490749 TGAGGACCTCTGAAGGCAGAAGG + Intronic
1010878388 6:81137981-81138003 TGGGGATCCATTAAGGCAGCAGG + Intergenic
1012606811 6:101167930-101167952 TGGGGATGCCAGAAGGGAGATGG - Intergenic
1017152417 6:151292521-151292543 TGGGAACCCCTGGATCCAGAGGG - Intronic
1017981292 6:159402708-159402730 AGGGGAACCCTGAAACCAGAGGG + Intergenic
1018004125 6:159604475-159604497 TGGGCTCCCCTGAAGCCAGAGGG - Intergenic
1018381392 6:163261132-163261154 TGGGGAGCCGGGAAGACAGAGGG - Intronic
1018855345 6:167670503-167670525 CTGGGCTCCCTGCAGCCAGAGGG + Intergenic
1020749860 7:12127029-12127051 TGGGCATCCCAAAAGCTAGAGGG - Intergenic
1022041761 7:26588203-26588225 TGGGGAGCCCTGAAGATAGGAGG - Intergenic
1022107375 7:27206064-27206086 TGAGAGTCCCTGGAGCCAGACGG - Intergenic
1023649327 7:42352025-42352047 GGCTGATCCCAGAAGCCAGAGGG - Intergenic
1023842315 7:44104446-44104468 TGGGGGGCTCCGAAGCCAGAGGG - Exonic
1024769022 7:52696400-52696422 GGGGGATCCATGCAGCCAGTGGG + Intergenic
1027393528 7:77728955-77728977 TGGGGAAGAGTGAAGCCAGATGG + Intronic
1027651391 7:80873005-80873027 TGGGGATCCCTGAAGCCCCCAGG - Intronic
1029176254 7:98666713-98666735 TTGGGATTTTTGAAGCCAGATGG - Intergenic
1033038165 7:137894509-137894531 TGGGCACCCCTGAAGCCAATGGG - Intronic
1034404736 7:150895940-150895962 TGGGGCTACCAGAAGCCAGATGG + Intergenic
1035072980 7:156158413-156158435 TGGGTATCCCTGATGACACAGGG + Intergenic
1035087867 7:156276919-156276941 TGGGGAGCCAGGAAGCCAGTCGG + Intergenic
1041220840 8:55649235-55649257 TTGGGATCCATCAAGGCAGAAGG - Intergenic
1048166184 8:132063326-132063348 TGGGGACCTCTGAATCCAGTGGG + Intronic
1048829732 8:138464482-138464504 TGGAGATCACTGAGGCCAGAGGG - Intronic
1049304547 8:141894026-141894048 TTGGGCTCACTGAAGCCAGGAGG - Intergenic
1049473663 8:142787255-142787277 TGGGGAGCCCTGTGGGCAGAAGG + Intergenic
1052388749 9:27853700-27853722 TGAGGATCACTTAAGCCAGGAGG - Intergenic
1052643485 9:31200617-31200639 TGGGGTTCACTGATGCCAGAAGG - Intergenic
1053736129 9:41104180-41104202 TGGGGATCCCAAGAGCCAGTGGG - Intergenic
1054692134 9:68326680-68326702 TGGGGGTCCCAAGAGCCAGAAGG + Intergenic
1054692245 9:68327220-68327242 TGGGGATCCCAAGAGCCAGTGGG + Intergenic
1058485520 9:105440039-105440061 TGGGGATGCATGAAGTGAGAAGG - Intergenic
1059990690 9:119862456-119862478 TGTGGCTCTCTGAAGCCAGGTGG - Intergenic
1060087532 9:120715179-120715201 TGGAGACCCCTGAGGGCAGAAGG + Intergenic
1060263889 9:122098835-122098857 TGGGGACCCCTGAAGCTATATGG + Intergenic
1060424187 9:123491200-123491222 TGAGGTTCCCTGACACCAGAAGG + Intronic
1061088922 9:128415610-128415632 TGGGGATCCAGGAAGGGAGAGGG + Intronic
1061514140 9:131078915-131078937 TGTGGACCCCTGGAGGCAGAGGG - Intronic
1061520272 9:131113693-131113715 TGGGGAGCCCTGAAGCCATGAGG + Intronic
1062379102 9:136278243-136278265 TGGGGCTCCCAGGAGCCAGAGGG - Intergenic
1186904591 X:14097799-14097821 TGCAGATCCCTCAAGGCAGAGGG - Intergenic
1187259533 X:17672511-17672533 TGGTGACCAGTGAAGCCAGATGG + Intronic
1187373169 X:18727294-18727316 TGAGAACCCCTGAGGCCAGAGGG + Intronic
1192481128 X:71487119-71487141 TGGGAGTCCCTGAAGGAAGAGGG - Intronic
1199394050 X:147312858-147312880 TCGGAAACTCTGAAGCCAGAAGG - Intergenic
1200002973 X:153071761-153071783 TGCGGGTCCCTGAAGCCGGATGG + Intergenic
1200004750 X:153078248-153078270 TGCGGGTCCCTGAAGCCGGATGG - Intergenic
1200066428 X:153506270-153506292 TGGGGCTCCCGGAAGCCACCCGG - Intronic
1200695328 Y:6353585-6353607 TTGAGATCCCTTAAGCCAGGGGG - Intergenic
1201039949 Y:9821125-9821147 TTGAGATCCCTTAAGCCAGGGGG + Intergenic