ID: 1129930209

View in Genome Browser
Species Human (GRCh38)
Location 15:79404276-79404298
Sequence TGGTTGGTCTTCTTAAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129930199_1129930209 24 Left 1129930199 15:79404229-79404251 CCTGTTAGGTGGAGGGGCCTATT 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1129930209 15:79404276-79404298 TGGTTGGTCTTCTTAAGGGCTGG 0: 1
1: 0
2: 1
3: 17
4: 128
1129930200_1129930209 7 Left 1129930200 15:79404246-79404268 CCTATTGTAATCATCCTGCCACC 0: 1
1: 0
2: 2
3: 29
4: 146
Right 1129930209 15:79404276-79404298 TGGTTGGTCTTCTTAAGGGCTGG 0: 1
1: 0
2: 1
3: 17
4: 128
1129930198_1129930209 25 Left 1129930198 15:79404228-79404250 CCCTGTTAGGTGGAGGGGCCTAT 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1129930209 15:79404276-79404298 TGGTTGGTCTTCTTAAGGGCTGG 0: 1
1: 0
2: 1
3: 17
4: 128
1129930203_1129930209 -7 Left 1129930203 15:79404260-79404282 CCTGCCACCACATGGCTGGTTGG 0: 1
1: 0
2: 0
3: 30
4: 183
Right 1129930209 15:79404276-79404298 TGGTTGGTCTTCTTAAGGGCTGG 0: 1
1: 0
2: 1
3: 17
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129930209 Original CRISPR TGGTTGGTCTTCTTAAGGGC TGG Intronic
902179637 1:14678172-14678194 GGGTGGGTCTTCCTGAGGGCAGG - Intronic
905201605 1:36320383-36320405 GGGTGGGGCTTCTCAAGGGCAGG - Exonic
905307900 1:37032144-37032166 GGGATGCTCTTCCTAAGGGCTGG + Intronic
905770218 1:40633048-40633070 GGGTGAGTCTTATTAAGGGCAGG - Exonic
910623053 1:89276854-89276876 TGGTTGGTCTTCTTGAAGGGTGG + Intergenic
915043192 1:152985471-152985493 TGCTTGGTCTTCTGCTGGGCTGG - Exonic
915047733 1:153032586-153032608 TGCTTGGTCTTCTGCTGGGCTGG - Exonic
915551017 1:156634346-156634368 TGGTTGATCTCCTTGAGGGCTGG + Intergenic
915615971 1:157038724-157038746 TGGAAGGTGTTCTTAAGGTCTGG - Intronic
916010678 1:160702709-160702731 TGGTTGGTGTCCTTCATGGCCGG + Intronic
921658481 1:217769510-217769532 TTGATGGTGTTCTTTAGGGCTGG + Intronic
922236166 1:223724223-223724245 TGGCTGGTCTTCTTGGGGACTGG - Intronic
922373788 1:224940245-224940267 TGGCAGGTCTCTTTAAGGGCTGG + Intronic
923312122 1:232745291-232745313 TGGTTTGTCTCCTTAAGGGATGG - Intergenic
923312415 1:232747785-232747807 TGGTTTGTCTCCTTAAGAGATGG - Intergenic
923793811 1:237134236-237134258 TGGTTGTTCTTTCTAAGGGAGGG - Intronic
924319609 1:242835742-242835764 TGGGTGGACTGCTTAAGGTCAGG + Intergenic
1068434040 10:56968108-56968130 TGGTTGGTCTCCTCAAAGGATGG + Intergenic
1069701357 10:70428907-70428929 TGTTTGGGCTTCCTCAGGGCTGG - Intergenic
1070918130 10:80167912-80167934 TGGATTGTCTTCCTAGGGGCTGG + Intronic
1074255561 10:111798992-111799014 TGGTTTCTGTTCTCAAGGGCGGG - Intergenic
1078474558 11:11620246-11620268 TGTGTGAGCTTCTTAAGGGCAGG - Intronic
1081972679 11:47210769-47210791 TGGTTGGTCTGAATAAGGGGAGG + Intergenic
1085702566 11:78757907-78757929 TGGATGGGCTTCTTCAGGACTGG + Intronic
1088742224 11:112776567-112776589 TGGTTGGTCTCCTCAAGGTATGG + Intergenic
1093021645 12:14209381-14209403 TGATTGGTCTCCTTGAGGGATGG + Intergenic
1094567366 12:31611787-31611809 TAGTTGGACTTCTTAAGTGCAGG + Intergenic
1096050236 12:48601055-48601077 TGGGTGGTCTTCTCACGGACTGG + Intergenic
1100275690 12:93069872-93069894 TGGTTGCTTTTCTCAAGAGCAGG - Intergenic
1102130296 12:110523184-110523206 TCCTTGGCCTTCTAAAGGGCCGG - Intronic
1104350028 12:128037131-128037153 AGGTCTGTCTTCTGAAGGGCAGG + Intergenic
1116241697 14:42351972-42351994 GGGTGGGTCTTCTTGAGGGTAGG - Intergenic
1128741052 15:70083803-70083825 GGCTAGGACTTCTTAAGGGCAGG + Intronic
1129930209 15:79404276-79404298 TGGTTGGTCTTCTTAAGGGCTGG + Intronic
1129953459 15:79612143-79612165 TGGCTGGTCTCCTTGAGGTCTGG - Intergenic
1130641848 15:85683775-85683797 TGGTTGATTTTCTTAAATGCTGG - Intronic
1131939643 15:97546751-97546773 TGGTTGGTCTCCTTTAGGGATGG + Intergenic
1135220919 16:20613379-20613401 TGGTTGGCTATCTTAAAGGCTGG + Intronic
1136474726 16:30505626-30505648 TGGTTGGCCTCCTGAAGTGCTGG - Intronic
1137511176 16:49102048-49102070 TGATTGGTCTCCTCAAGGGATGG + Intergenic
1137580466 16:49630686-49630708 TGGTTGATCTTCTCAGGGGCAGG + Intronic
1137790486 16:51170756-51170778 TGGGTGGACTTCTTGAGGGTGGG + Intergenic
1142917495 17:3153914-3153936 TGGTTAGACTTCTCAAGGGCAGG - Intergenic
1146715888 17:35087014-35087036 TGTTTTGTCTTCTTAAATGCTGG + Intronic
1146986628 17:37226306-37226328 TTGTTGGTTTTCTTAAAGGAGGG - Intronic
1151628571 17:75293955-75293977 GGGTTGGTCATCTTGAGGTCAGG + Intergenic
1152178199 17:78801580-78801602 TGTTTTGTTTTCTTTAGGGCTGG - Intronic
1153016402 18:586000-586022 TGGCTGGTCTCCTTGAGGGATGG + Intergenic
1155876941 18:31100975-31100997 TGGTTGGCCTTATTTGGGGCGGG - Intronic
1156966301 18:43097844-43097866 TGGATGGTCTTCCAAAGGACAGG - Intronic
1157237509 18:45978444-45978466 TGGTTGGTTTCCTTGAGGACTGG - Intergenic
1167888712 19:52522786-52522808 GGGGTGTTGTTCTTAAGGGCGGG + Intergenic
1167915852 19:52739723-52739745 GGGGTGTTGTTCTTAAGGGCGGG - Intergenic
925179580 2:1808349-1808371 TGTCTGGTGTTCCTAAGGGCAGG - Intronic
928480193 2:31675527-31675549 TTGTTGGTTTTCTTAAATGCTGG + Intergenic
930912086 2:56641214-56641236 TGTTTGGTCTTCTTAAGGAATGG + Intergenic
931821187 2:65953973-65953995 TGGTTGGTCTTCTTGAGGAATGG + Intergenic
936102778 2:109597997-109598019 TCATTGGTCTGCTTAAGGGGTGG - Intronic
936443621 2:112577961-112577983 TGGTTGGGATTCTTAACAGCAGG - Intergenic
938561031 2:132471998-132472020 AGGTTGGTCTTCTCAAGGAATGG + Intronic
939961810 2:148571795-148571817 TGGTTGGTCTTCATGAGGGATGG + Intergenic
941016044 2:160357788-160357810 CGGTTTGTCTTCTTAGGGGGTGG - Intronic
941408544 2:165123006-165123028 TGGTTTGTCTTCCTAAGTGAAGG - Intronic
941552320 2:166932775-166932797 TGGTTGGTCTTTTCAAGCGGTGG - Intronic
942501236 2:176592831-176592853 TGGTTGTTCCTCTTGAGAGCAGG - Intergenic
945293422 2:208147272-208147294 TGATTGGTCTTCTCAAGGCATGG + Intergenic
946829472 2:223713174-223713196 GTGTTGGTCTTCTGAAGTGCTGG - Intergenic
948369284 2:237477448-237477470 TGTTTGGTCTTCTCAGGGGATGG + Intergenic
1170373684 20:15677647-15677669 TGGTTGGTTTTCCTGAGGGTTGG - Intronic
1171222649 20:23414071-23414093 TGGTTGGTCTCCCACAGGGCTGG - Intronic
1172639638 20:36432958-36432980 AGATTTGTCTTCTAAAGGGCAGG - Intronic
1178311462 21:31533502-31533524 GGGTTGGCCTTCCTAAGTGCTGG - Intronic
1183169846 22:36179832-36179854 TGGGTGGACTGCTTAAGGCCAGG + Intergenic
1184045809 22:41971634-41971656 TGGATGGTCTTCCTGAGGACGGG - Intergenic
951031103 3:17882489-17882511 TGGGTGGACTGCTTAAGGTCAGG - Intronic
952452004 3:33441067-33441089 CTGTTGGTCATCCTAAGGGCAGG + Intronic
953280265 3:41548048-41548070 GGGTTGGTATCCTAAAGGGCTGG - Intronic
954571524 3:51645007-51645029 TGGCTTGTCTTTTAAAGGGCCGG + Exonic
957152311 3:76501271-76501293 TGGTTTGTCTTCTCAAGGGAGGG + Intronic
957328914 3:78734347-78734369 AGGTTGGTCTTCTGTAGGGCTGG - Intronic
958484956 3:94693548-94693570 TAGTTGGTCTTCGTAAGGGATGG + Intergenic
960137076 3:114116274-114116296 TGGTTGGTCTTCTTGAGGGATGG - Intergenic
961902961 3:130232202-130232224 TGGATGAACTTCTTGAGGGCAGG - Intergenic
962776362 3:138664186-138664208 TGGGTGGTCTTCACAGGGGCTGG + Intronic
964093022 3:152898211-152898233 TGGTTGGACATCTTAGGAGCAGG + Intergenic
967276974 3:187785418-187785440 TCCTTGGTCTTCTAAAGTGCTGG + Intergenic
968411277 4:392706-392728 TGCTTGGTTTTCATAAGGGCAGG + Intergenic
971184656 4:24362165-24362187 TGGGTGAACTTCTGAAGGGCAGG - Intergenic
974489723 4:62549189-62549211 TGGTTAGTATTCTTAAGTGTTGG - Intergenic
977053085 4:92154428-92154450 TGCTTGGTCTCCTTTAGTGCTGG + Intergenic
977867836 4:102050987-102051009 TGGCTGGTCTTTTGTAGGGCAGG + Intronic
979060503 4:116053524-116053546 CGGTAGGTCTTCTAAAGTGCTGG + Intergenic
982201230 4:152963006-152963028 TGATTTGTCTTCTTTAGGGAGGG + Exonic
983741285 4:171137977-171137999 TGGTTGGTCTATTTCAGGGAAGG - Intergenic
986599108 5:9453470-9453492 TGGCTGGTATTCCTAAGTGCAGG + Intronic
987936672 5:24475797-24475819 TGATGGGTGTTCTTAAGTGCAGG - Intergenic
990876471 5:60492184-60492206 TCCTTGGCCTTCTAAAGGGCTGG - Intronic
991300252 5:65122831-65122853 TGGTTGGTCTCCTTGATGGATGG - Intergenic
992082717 5:73250515-73250537 TCATTGGTCTTATTAAGGTCTGG + Intergenic
994115996 5:96061986-96062008 TGTTTGGTTTTCTTGAGGGATGG - Intergenic
994633338 5:102313374-102313396 TTGTTGGTCTTCCAAAGGGTTGG - Intergenic
995015792 5:107307176-107307198 TATTTGGTCTTCTCAAGGGATGG + Intergenic
995291696 5:110463816-110463838 TGGGTGGTCTTATGTAGGGCAGG - Intronic
998847524 5:146325399-146325421 TGGGTAGTCTTCTTGAGGGAGGG + Intronic
1000887112 5:166759753-166759775 TCTTTGGTCTTCTGAAGTGCTGG + Intergenic
1013987353 6:116211105-116211127 TAGTTGGACTTCTTAAGTGGCGG - Intronic
1014059243 6:117051518-117051540 TGGGTGGTGTTCTTGAGGGATGG + Intergenic
1020107243 7:5427839-5427861 TGGCTGGGCGTCTTAAGCGCCGG + Intergenic
1020399570 7:7760104-7760126 TGGTTGGACTTCTTAAATGGTGG - Intronic
1021575119 7:22099551-22099573 TGGTTGGTCTTCTCAAAGGGTGG + Intergenic
1021807369 7:24370773-24370795 TGGGTGGACTCCTAAAGGGCAGG + Intergenic
1024347905 7:48331817-48331839 TGGTTGTTCTGCTTCAGTGCTGG - Intronic
1028339789 7:89704583-89704605 TGGTTGATTTTTTTAATGGCCGG - Intergenic
1029170372 7:98625847-98625869 GGAGTGGTCTTCTCAAGGGCTGG + Intronic
1030157994 7:106476400-106476422 TGGTTGAACTTCTCAAGGGGTGG - Intergenic
1032302187 7:130697529-130697551 TGGGTGGACTACTTAAGGCCAGG + Intergenic
1034427310 7:151020844-151020866 GGGTTGGGCTTCGGAAGGGCAGG - Intronic
1035050766 7:155997979-155998001 TGGTTCCTCTTCTTAATGCCAGG + Intergenic
1038184002 8:25256260-25256282 TGGTTAATCTTCTAAATGGCAGG + Intronic
1041395906 8:57391005-57391027 GGGTTGTTCTTCTGGAGGGCAGG - Intergenic
1042692002 8:71510291-71510313 TGGTTTGGCTGCTTTAGGGCTGG - Intronic
1043005925 8:74818534-74818556 TGCTTATTCTTCTTCAGGGCTGG + Intronic
1043395232 8:79828993-79829015 TGGTTGATTTTTTTAAGTGCTGG - Intergenic
1048705602 8:137149705-137149727 TGGTTAGTCTTTTTAATGGTAGG - Intergenic
1049873890 8:145002915-145002937 TGGTTGGTGAGCTGAAGGGCAGG - Intergenic
1052854224 9:33397141-33397163 CGGTTTTTCTTCCTAAGGGCTGG + Intronic
1053161361 9:35815407-35815429 TGGTTCGTCCTCTTCAGGTCTGG + Intronic
1053428231 9:38025167-38025189 TGGTTGGTCCTTGTAAGGGGAGG - Intronic
1053682235 9:40493302-40493324 CGGTTTTTCTTCCTAAGGGCTGG + Intergenic
1053932219 9:43121629-43121651 CGGTTTTTCTTCCTAAGGGCTGG + Intergenic
1054281479 9:63131627-63131649 CGGTTTTTCTTCCTAAGGGCTGG - Intergenic
1054295333 9:63328802-63328824 CGGTTTTTCTTCCTAAGGGCTGG + Intergenic
1054393351 9:64633306-64633328 CGGTTTTTCTTCCTAAGGGCTGG + Intergenic
1054428000 9:65138520-65138542 CGGTTTTTCTTCCTAAGGGCTGG + Intergenic
1054502378 9:65883024-65883046 CGGTTTTTCTTCCTAAGGGCTGG - Intronic
1055663275 9:78528563-78528585 GGGTTAGTCTTCTTAAGGTCAGG + Intergenic
1056765258 9:89441217-89441239 GGGTTGGTATTCGTAAGGTCTGG - Intronic
1056843507 9:90017983-90018005 TGGTTGGCCTACTTGAGGGACGG - Intergenic
1057713356 9:97467164-97467186 TTGTTGAACTTCCTAAGGGCCGG - Intronic
1057743947 9:97736708-97736730 TGGTTGTCGTTCTTAAGGCCAGG + Intergenic
1059717129 9:116923657-116923679 TGGTTGTTCTGCATTAGGGCTGG + Intronic
1189397285 X:40634239-40634261 TGGTTGGTCTGTTTAAGAGATGG + Intronic
1190113934 X:47613431-47613453 TGGTTGGCCTTCTGGAGGGATGG - Intronic
1194265527 X:91749061-91749083 TGGTTGGTCTGCTTATGGGGTGG - Intergenic
1198262890 X:134982248-134982270 TGGTTGGTCTTACATAGGGCAGG - Intergenic
1200582679 Y:4969509-4969531 TGGCTGGTCTGCTTATGGGGTGG - Intergenic
1201313321 Y:12618014-12618036 AGTTTGGCCTTCTAAAGGGCTGG + Intergenic