ID: 1129930381

View in Genome Browser
Species Human (GRCh38)
Location 15:79405599-79405621
Sequence GCTTCCAGGCATTCAGTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129930381_1129930385 11 Left 1129930381 15:79405599-79405621 CCGACCACTGAATGCCTGGAAGC 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1129930385 15:79405633-79405655 GACCAGCCCCTGAATTTTCATGG 0: 1
1: 0
2: 0
3: 18
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129930381 Original CRISPR GCTTCCAGGCATTCAGTGGT CGG (reversed) Intronic
900497937 1:2984836-2984858 GCTTCAAGGCATTCAGCAGCTGG + Intergenic
903682539 1:25106838-25106860 GCCTCCAGGCATCCCATGGTGGG + Intergenic
903705302 1:25281163-25281185 AGTTCCAGGCATTCAGAGCTGGG + Intronic
907032900 1:51190050-51190072 GCTGCCAGGCATTCATTTGGAGG - Intergenic
907386196 1:54127175-54127197 GCTTCCAGACACTGAGTGGCAGG + Intergenic
913613402 1:120530762-120530784 ATCTCCAGGCACTCAGTGGTGGG - Intergenic
914577783 1:148991485-148991507 ATCTCCAGGCACTCAGTGGTGGG + Intronic
918363257 1:183780516-183780538 CCATCCAAGCATTCAGTGCTGGG - Intronic
920618781 1:207523698-207523720 GCTTCCAGGATTGCAGCGGTAGG - Exonic
920620563 1:207542269-207542291 GCTTCCAGGATTGCAGCGGTAGG - Exonic
920622345 1:207560826-207560848 GCTTCCAGGATTGCAGCGGTAGG - Exonic
920635073 1:207694440-207694462 GCTTCCAAGATTGCAGTGGTAGG - Exonic
920636601 1:207710469-207710491 GCTTCCAAGATTGCAGTGGTAGG - Intronic
922780315 1:228247131-228247153 GCTGCCAGACATTCAGTAGAAGG - Intronic
923786397 1:237072373-237072395 GCTTCCAGGCATTGAGCGGATGG + Intronic
1064284094 10:13977361-13977383 GCTTAACGGCATTCAGTGGATGG - Intronic
1065455836 10:25905822-25905844 GGTTTCAGGCATTCACTGGGGGG + Intergenic
1065841988 10:29709816-29709838 GCTTGCAGGCACCCAGTGGGTGG + Intronic
1066241750 10:33543195-33543217 GCTGCCAGGCCTTTAGTGGAAGG - Intergenic
1066377052 10:34867073-34867095 GCTGCCAGGGGATCAGTGGTAGG + Intergenic
1066388906 10:34963218-34963240 GCTTTCAGCCATTCAGTTGGTGG + Intergenic
1067940534 10:50651238-50651260 GCTTCCAGCCTTCCAGAGGTTGG - Intergenic
1070488119 10:76950567-76950589 CCATCCAGGCATGCAGTGGGTGG - Intronic
1071784343 10:88881427-88881449 GCTTCCTGGAAATCAGTGTTCGG + Intronic
1076728348 10:132424232-132424254 GTGGCCTGGCATTCAGTGGTGGG + Intergenic
1077211898 11:1375057-1375079 CCTTCCAGGGACTCAGAGGTGGG - Intergenic
1078075842 11:8159616-8159638 GTTTCCATGAATACAGTGGTGGG + Intronic
1081960987 11:47137210-47137232 GCTTCCAGATATTCTGTGGATGG + Intronic
1084357416 11:68649238-68649260 TTTTCCTGGCATTCAGTAGTCGG - Intergenic
1086503619 11:87479340-87479362 GCTTCCAGGCCTGCAATGGGAGG - Intergenic
1086582605 11:88416290-88416312 TATTCAATGCATTCAGTGGTGGG + Intergenic
1089926506 11:122263940-122263962 GCTTACATTCATTCAGGGGTAGG - Intergenic
1090577102 11:128117064-128117086 GCTTCCTGCCAGTCAGTGTTTGG - Intergenic
1101336685 12:103802918-103802940 CCATCCAGGCATTCAGAGGAGGG + Intronic
1101930965 12:109013848-109013870 GGTTCCAGGAACTCGGTGGTGGG - Intronic
1101945103 12:109130587-109130609 GCTTCCCCGCATTCAGCTGTAGG + Intronic
1104226799 12:126842818-126842840 GCTTCCAGACACTCAGAGATTGG - Intergenic
1104291837 12:127476501-127476523 GCTTTGAGGCATTCATTGTTTGG + Intergenic
1104405179 12:128511029-128511051 GCTGGCAGGCATGGAGTGGTTGG + Intronic
1106322219 13:28652097-28652119 GCTTCCATGTATTCAAGGGTTGG - Intergenic
1106851285 13:33795549-33795571 CCTTCCAAGCTTACAGTGGTGGG - Intergenic
1106925704 13:34610689-34610711 GGGTCCAGGCATTCAGTGCATGG + Intergenic
1107768210 13:43760475-43760497 GGTTCCAGGCATTCGGGGGAGGG - Intronic
1111090819 13:83444524-83444546 GATTCCAGGGAAGCAGTGGTAGG - Intergenic
1111181334 13:84670433-84670455 GCTTCCAGGCATGCTGTCCTTGG - Intergenic
1112833389 13:103481359-103481381 GTCTCCAGGCATTCAGTCGAAGG - Intergenic
1112936201 13:104802537-104802559 ACATCCAGGCATTCAGTTTTTGG - Intergenic
1119470330 14:74893501-74893523 GCTGCCAGGCATTCAAAGGTAGG - Intronic
1121008528 14:90505860-90505882 GATTCCAGGCCTTCTGTGTTGGG + Intergenic
1121033226 14:90676856-90676878 ACTTCCAGGACTTCAGTGTTTGG - Intronic
1129739865 15:77984993-77985015 GCTTCCAGGCCTTCAGGGTTTGG - Intronic
1129763139 15:78143497-78143519 GCTTCAAGGGAGACAGTGGTGGG + Intronic
1129930381 15:79405599-79405621 GCTTCCAGGCATTCAGTGGTCGG - Intronic
1130911465 15:88273789-88273811 GCTTCCAGGCATGCAGAGCTCGG - Intergenic
1131245149 15:90785421-90785443 GTTTCCAGGCATTAGGGGGTGGG - Intronic
1131841140 15:96438949-96438971 GCTACCATGCATTGTGTGGTAGG - Intergenic
1131933460 15:97473647-97473669 CCTTCCAGCCATTGAGTGGCAGG + Intergenic
1132101529 15:99026701-99026723 GGTTCCAGGCATTTGGAGGTGGG + Intergenic
1132456805 16:28648-28670 GCTTCCAGACAGTCAGTGCTGGG - Intergenic
1135165644 16:20136826-20136848 GTTTCAAGGCATTAAGTCGTGGG + Intergenic
1135412329 16:22244620-22244642 GCTTCCAGGCTTCCTGTGGAAGG - Exonic
1136576429 16:31127967-31127989 GCTCCAAAGCATGCAGTGGTGGG + Intronic
1139244902 16:65432202-65432224 GCCTACAAGCATTCAGAGGTAGG - Intergenic
1141866816 16:86755946-86755968 GATTACAGGCATGCACTGGTGGG - Intergenic
1142615308 17:1130826-1130848 GGCTCCAGGCATTCCTTGGTTGG - Intronic
1142998784 17:3777477-3777499 GCTTCCAGGCAATCTGAGATGGG - Intronic
1144027909 17:11294690-11294712 GGTTTCAGGCATTCAGTCTTGGG - Intronic
1145878378 17:28336394-28336416 GGTTCCAGGAATTCTGTGGCAGG - Intronic
1148096410 17:45055495-45055517 GGTTCCAGCTATTCAGTGGGAGG - Intronic
1148650932 17:49249581-49249603 GCTTCCAGGGCTTCTTTGGTAGG - Intergenic
1149657499 17:58318076-58318098 GCTTGCAGGCAGGCAGTGGAGGG + Intronic
1151813867 17:76461385-76461407 CCTTACAGACAGTCAGTGGTTGG - Intronic
1152117529 17:78397759-78397781 GCTTCCAGGCTTGGAGTGGAGGG - Intronic
1152530270 17:80914519-80914541 GCTTCCAAGCCTGCAGGGGTAGG - Intronic
1157579573 18:48765511-48765533 GCTGCCAGGGCTTCAGTGATGGG + Intronic
1158106950 18:53896228-53896250 TCCTCCAGGTATTCAGTGTTAGG - Intergenic
1159927494 18:74282068-74282090 GCTCCCAGGCAGTCAGTAGAAGG - Intronic
1160254455 18:77235988-77236010 CCTTCCTGGCAATCAGTGGCTGG + Intergenic
1161555011 19:4936185-4936207 GCTTCCAGGGATGCAGTGAGAGG + Intronic
1163225040 19:15954584-15954606 GCTTCCAGGTATTCAGACTTAGG + Intergenic
1167029586 19:46948734-46948756 GCTTCCAGGCTACCACTGGTTGG - Intronic
1168465573 19:56598502-56598524 GGGTACAGGCATTAAGTGGTAGG + Intronic
1168475504 19:56672007-56672029 GCTTCCAGTAACTCAGGGGTGGG + Intergenic
926813634 2:16779027-16779049 TTTTCCAGGCATTCAGTTGGTGG - Intergenic
927878076 2:26672122-26672144 GCTTCCAGGCAGTCAGGCTTGGG - Intergenic
928116800 2:28550960-28550982 GCTTCCAGGCACCCAGGGGATGG - Intronic
932815960 2:74862128-74862150 TCTTACAGTCATCCAGTGGTAGG + Intronic
934188169 2:89764067-89764089 GGTGCCAGGCATGCAGGGGTGGG + Intergenic
936495713 2:113019020-113019042 GTTGTCTGGCATTCAGTGGTGGG + Intergenic
937948003 2:127359017-127359039 GCTGCCAGGCATTCAGGAGGAGG + Intronic
940035084 2:149304309-149304331 GCTCCCAGGCATTCTGGGGTTGG + Intergenic
941232365 2:162926707-162926729 TATTCCAGGCATTTAGTTGTGGG + Intergenic
942469292 2:176242952-176242974 GCTTCTACCCATTCAGTGGCCGG - Intergenic
946482327 2:220069048-220069070 TCCTCCAGGAACTCAGTGGTGGG + Intergenic
948719405 2:239889228-239889250 GATTCCAGCCATCCAGTGGGTGG - Intergenic
1168835453 20:874400-874422 GCCTCCAGGCTTTCTGTGGTCGG - Exonic
1169352513 20:4880724-4880746 GCACCCAGGCATGCAGAGGTGGG - Intronic
1170778461 20:19401849-19401871 GCTTCCTGGAATTCACTCGTGGG + Intronic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1174177356 20:48653376-48653398 ACTTCCAGGCATTCCGGAGTCGG - Exonic
1179838067 21:44050572-44050594 GCTTCCAGGCATGGCGTGTTGGG + Intronic
1180061350 21:45386550-45386572 GCTTCCAGGCAGGCAGCGGCTGG + Intergenic
1181139371 22:20792800-20792822 GCTTCCAGGCCTGCACTTGTGGG + Intronic
1184747282 22:46463702-46463724 GCTTCGAGGACTTCACTGGTAGG - Exonic
949313328 3:2724695-2724717 GCCTGCAGGCATTCTGTGATTGG + Intronic
950980818 3:17302684-17302706 TCTTCTAGGGATTCAGTGGATGG - Intronic
951019943 3:17771853-17771875 GCTGTCAGTCATTCACTGGTAGG - Intronic
954296694 3:49678270-49678292 GGTTGCAGGGATGCAGTGGTGGG + Intronic
958004798 3:87797252-87797274 GGTTTCAGGCATTCACTGGGGGG + Intergenic
960458110 3:117898981-117899003 CCTTTCAGGCAGTCAGTGCTAGG - Intergenic
960637483 3:119797450-119797472 GCCTCCAGGCATTCAGCTATCGG + Intronic
960943687 3:122951951-122951973 GCTTGCAGCCATTCAGTGATGGG - Intronic
961466181 3:127083008-127083030 GATTCCATGCATGCAGTGCTGGG - Intergenic
964200455 3:154113160-154113182 TCTTCCAGGCATTCAGGGATGGG + Intergenic
967110581 3:186289948-186289970 GGTTCCAGGGATTCAGTTGTGGG + Intronic
968969541 4:3786429-3786451 GCTGCCAGCCAATCAGTGCTGGG + Intergenic
969363961 4:6683108-6683130 GGCTCCAGGCATTCAGAGGTGGG + Intergenic
969560216 4:7942026-7942048 GGGGCCAGGCTTTCAGTGGTGGG - Intergenic
979865003 4:125743521-125743543 GCATCCAGGCAGTAAGTTGTAGG - Intergenic
980729321 4:136806113-136806135 GCTTCCAGGGTATCTGTGGTTGG - Intergenic
986015625 5:3754640-3754662 ACTTCCAGAGAGTCAGTGGTGGG - Intergenic
988209657 5:28187245-28187267 GTTTCCAGGCTTTCAGTATTAGG + Intergenic
990983361 5:61620884-61620906 GGTTCCAGGGGTTCAGTGATTGG + Intergenic
991551804 5:67845150-67845172 GCTTCCCGGCATTCATTGAATGG - Intergenic
993459636 5:88167310-88167332 TCTCCCTGGCATCCAGTGGTAGG - Intergenic
994062697 5:95498553-95498575 GCTTGAAGGCTTTCTGTGGTTGG + Exonic
996954716 5:129169105-129169127 GCTTCTGGGCATTGAATGGTAGG + Intergenic
997758535 5:136422859-136422881 GCTTCCAGTCATGCAGATGTTGG + Intergenic
1000177729 5:158774259-158774281 GCTTGCAGGCAATCTGTGCTTGG + Intronic
1001017849 5:168157660-168157682 GCCTCCAAGGTTTCAGTGGTGGG + Intronic
1001517491 5:172366107-172366129 TCTTCCAGGCAGGCAGTCGTTGG + Intronic
1002853933 6:1021088-1021110 GCTTCCAGGTATACCGTGGTGGG - Intergenic
1004195326 6:13499287-13499309 GCTTCAAGCCATTAAGTTGTGGG - Intergenic
1013360024 6:109385216-109385238 TCTTATAGGCATTCAGGGGTGGG + Intergenic
1016812369 6:148273683-148273705 GCACCCATGCATTGAGTGGTTGG - Intronic
1018459399 6:163983472-163983494 GCTTTCTTGCAATCAGTGGTAGG + Intergenic
1021471759 7:21011081-21011103 GCTTCCTTGCTTTCAGAGGTGGG + Intergenic
1023020412 7:36007021-36007043 GCTTCCAAGCACCCAGTGGGAGG + Intergenic
1023991586 7:45132045-45132067 GCTGCCAGGGATGCAGGGGTGGG - Intergenic
1024698630 7:51883340-51883362 GCATCCAGGCAGACAGTTGTGGG - Intergenic
1027223194 7:76227059-76227081 GCTCTCAGCCAATCAGTGGTAGG + Intronic
1027223200 7:76227102-76227124 GCTCTCAGCCAATCAGTGGTAGG + Intronic
1027223206 7:76227145-76227167 GCTCTCAGCCAATCAGTGGTAGG + Intronic
1027223212 7:76227188-76227210 GCTCTCAGCCAATCAGTGGTAGG + Intronic
1028618442 7:92797483-92797505 GCTTCTAGGCATTTAGTGCCAGG + Intronic
1028963072 7:96771375-96771397 GCTACCAGGCATTCACTGTGGGG + Intergenic
1033094642 7:138419835-138419857 GCTTTCAGGCATACAGGGGATGG - Intergenic
1033314681 7:140287655-140287677 GGTTCCAGGCATTCAAACGTGGG - Intergenic
1033737794 7:144241028-144241050 GCTTCCAGGGCTGCAGTGGAAGG + Intergenic
1033745261 7:144309929-144309951 GCTTCCAGGGCTGCAGTGGAAGG - Intergenic
1035232742 7:157476266-157476288 CCTGCCAGGCACTCAGTGGCTGG - Intergenic
1037022406 8:13989675-13989697 GCTTCCAGGCAGCCTGTTGTGGG + Intergenic
1040111102 8:43567556-43567578 GCGTCCAGGCCTTCAGGGGGAGG - Intergenic
1043873561 8:85462060-85462082 GCTTCCCGGGATTCTGTGGAGGG - Intergenic
1044489564 8:92796916-92796938 GCTTCCAGGTCATCAGTTGTTGG + Intergenic
1047774927 8:128062132-128062154 CCTTCCAGGCATTCACCAGTTGG - Intergenic
1047800325 8:128302503-128302525 GCTTTCATGCATTCATTGTTTGG + Intergenic
1048101660 8:131358865-131358887 GCCTCCTGGCTGTCAGTGGTGGG + Intergenic
1048957220 8:139547101-139547123 ACTTCCAGGCACTCAGAGTTAGG - Intergenic
1050759462 9:9049194-9049216 GCCTTAAGGCATTCAGTGGAAGG + Intronic
1051662064 9:19434931-19434953 GCTTTCATGGATTCAGGGGTAGG + Exonic
1052493729 9:29199283-29199305 ACTTCCTGGCTTTCTGTGGTTGG - Intergenic
1059392258 9:114006599-114006621 GCTTCCAGTCATTAAGTTTTAGG - Intronic
1060800299 9:126540278-126540300 GGTTCCAGGCATCCACTGGGGGG - Intergenic
1060971345 9:127739936-127739958 GCTTCCAGGACTGCAGTGGATGG - Intronic
1061628397 9:131856035-131856057 CCTTTCATGCAGTCAGTGGTGGG + Intergenic
1188325693 X:28798204-28798226 GCATACAGGCATTCACTGCTAGG + Intronic
1190713005 X:53082826-53082848 GCTTCCAGGCTCTCCGTGGGCGG - Exonic
1190997240 X:55621856-55621878 GCTTCCAGGCTCTCCGTGGTTGG + Intergenic
1191254472 X:58273845-58273867 GCCGCCAGGCATTCAGGGGGAGG - Intergenic
1191255207 X:58276702-58276724 GCGTCCAGGCTTTCAGGGGAAGG - Intergenic
1195799597 X:108692904-108692926 GCATCCAGCCATTCATTAGTCGG + Exonic
1199719351 X:150531169-150531191 TCTTCCAGGCATTCAGGAATGGG - Intergenic
1200163698 X:154021847-154021869 GGTTACAGGGATTCAGTGGGGGG + Intronic
1200399557 X:156011075-156011097 GCTTCCAGACAGTCAGTGCTGGG + Intergenic
1200734208 Y:6776374-6776396 GATTACAGATATTCAGTGGTAGG - Intergenic
1201178437 Y:11323353-11323375 GCCTCCAGGCACTCCATGGTGGG - Intergenic