ID: 1129931379

View in Genome Browser
Species Human (GRCh38)
Location 15:79413746-79413768
Sequence TGTGTATCCCAGCACTATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129931378_1129931379 -10 Left 1129931378 15:79413733-79413755 CCTGGTTGGACAGTGTGTATCCC 0: 1
1: 0
2: 0
3: 10
4: 65
Right 1129931379 15:79413746-79413768 TGTGTATCCCAGCACTATCTAGG 0: 1
1: 0
2: 0
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129931379 Original CRISPR TGTGTATCCCAGCACTATCT AGG Intronic
901847877 1:11996019-11996041 TTTGTCTCTCAGCACTGTCTGGG + Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
905986610 1:42290471-42290493 TGAAAATCCCAGCACTATTTGGG + Intronic
907765132 1:57402497-57402519 GGTGTATTGCAGCAATATCTTGG - Intronic
907794525 1:57701900-57701922 TGTTTATTTCTGCACTATCTTGG + Intronic
908403851 1:63794819-63794841 TGTGTATCCCAGCACAGTCCCGG - Intronic
913446037 1:118951769-118951791 TTAGTGTCCCAGCCCTATCTGGG + Intronic
914789158 1:150861292-150861314 TGTGTTTCCCAGCCTGATCTTGG - Intronic
915125502 1:153660742-153660764 TGCCTATCCCAGCACCATTTAGG - Intronic
915824290 1:159058464-159058486 TGTGTATCCCAGCCCCAGCAGGG + Intergenic
923485168 1:234422898-234422920 TATGTATTCCAGCTGTATCTGGG + Intronic
924710163 1:246524635-246524657 TGTGTATCCCAGGACCACCCTGG - Intergenic
1064471161 10:15637326-15637348 TGTGTGTGCCTGCACTTTCTAGG - Intronic
1067466388 10:46502119-46502141 TGTGCAGCTCAGCACTCTCTGGG - Intergenic
1067620800 10:47882486-47882508 TGTGCAGCTCAGCACTCTCTGGG + Intergenic
1069223566 10:65913040-65913062 TGTTTATTGCAGCAATATCTTGG - Exonic
1069784343 10:70978298-70978320 TGTGTATCCCACCAGCACCTGGG + Intergenic
1085168637 11:74428194-74428216 GGAGTATAGCAGCACTATCTTGG + Intergenic
1085347201 11:75775887-75775909 TTTGTCTCCCAGCCATATCTTGG + Intronic
1092141673 12:6188170-6188192 TGTCTCTCCCAGCTGTATCTGGG - Intergenic
1102063095 12:109949979-109950001 TGTGTCTCCCAGCCCTGTCTAGG - Intronic
1108114524 13:47112258-47112280 TGTGTAGCCCATTCCTATCTGGG - Intergenic
1111715497 13:91874505-91874527 TGTTCATCACAGCACTATTTTGG - Intronic
1118079200 14:62338865-62338887 TGTGTCTCCCAGCGCTACCATGG + Intergenic
1120634795 14:86938470-86938492 TGAGTATCCCAGCACGACCCTGG - Intergenic
1121649581 14:95547915-95547937 TTTGCATCCCAGCACTTGCTGGG + Intergenic
1124595562 15:31088960-31088982 TGGGGCTCCCAGCACTTTCTTGG + Intronic
1125190455 15:36986621-36986643 TATCAATCCCAGCACTAGCTGGG + Intronic
1125223123 15:37363691-37363713 TGTGAATCCCAGCACACTGTGGG + Intergenic
1129917328 15:79285221-79285243 TGTATAACCAAGCACTTTCTTGG + Intergenic
1129931379 15:79413746-79413768 TGTGTATCCCAGCACTATCTAGG + Intronic
1132208980 15:100006605-100006627 GTTGTATTCCAGCACAATCTGGG + Intronic
1132765554 16:1532620-1532642 TCTCTGTCCCAGCACTGTCTTGG + Intronic
1136581762 16:31156276-31156298 CCTGTATCCCAGCACTTTGTGGG + Intergenic
1139015402 16:62683947-62683969 TGGGTATCCCTGCACTTTCATGG + Intergenic
1139062028 16:63263974-63263996 TGTGGATTCCACCTCTATCTTGG + Intergenic
1140999451 16:80294932-80294954 TGTGTCTCCCAGAAGAATCTGGG - Intergenic
1141847742 16:86622312-86622334 TGTCAATCCCAGCACTAGCATGG - Intergenic
1143203565 17:5128470-5128492 TGTGTATCCCAGGACCACCCTGG + Intronic
1145124575 17:20289560-20289582 TGTTAATCCCAGCACTTTTTGGG - Intronic
1145759392 17:27417631-27417653 TGTGTATCCCAGGACCACCCTGG + Intergenic
1145799654 17:27674699-27674721 TGTGTATCCCAGGCCTACCCTGG - Intergenic
1146472284 17:33134245-33134267 TGTGAATCCCAGCTCTACCTTGG - Intronic
1146482404 17:33215352-33215374 TATGTATCCTAGCACTATCCAGG + Intronic
1146845020 17:36176922-36176944 TGTGTATCCCAGGACCACCCTGG - Intronic
1146857327 17:36264857-36264879 TGTGTATCCCAGGACCACCCTGG - Intronic
1146863290 17:36323518-36323540 TGTGTATCCCAGGACCACCCTGG + Intronic
1146873241 17:36388767-36388789 TGTGTATCCCAGGACCACCCTGG - Intronic
1147066150 17:37924106-37924128 TGTGTATCCCAGGACCACCCTGG + Intergenic
1147076121 17:37989392-37989414 TGTGTATCCCAGGACCACCCTGG - Intronic
1147077682 17:38003667-38003689 TGTGTATCCCAGGACCACCCTGG + Intronic
1147087646 17:38068938-38068960 TGTGTATCCCAGGACCACCCTGG - Intergenic
1147093620 17:38127601-38127623 TGTGTATCCCAGGACCACCCTGG + Intergenic
1147103588 17:38192887-38192909 TGTGTATCCCAGGACCACCCTGG - Intergenic
1147207831 17:38851271-38851293 TGTGTGTCCCATTACTAACTTGG - Intronic
1149848166 17:60019405-60019427 TGTGTATCCCAGGACCACCCTGG - Intergenic
1149862008 17:60127140-60127162 TGTGTATCCCAGGACCACCCTGG + Intergenic
1150086518 17:62275987-62276009 TGTGTATCCCAGGACCACCCTGG - Intronic
1150358513 17:64507910-64507932 TGCAAATCCCAGCAATATCTAGG + Intronic
1150465357 17:65388057-65388079 TGTGGATGCCAGCAGTCTCTTGG - Intergenic
1155342274 18:24824857-24824879 TGCTTAAACCAGCACTATCTAGG - Intergenic
1156471447 18:37379551-37379573 TGTATATGCCAGCAAGATCTGGG + Intronic
1159359513 18:67381902-67381924 TGTGTAGCCCAGCCCTGCCTGGG - Intergenic
1161314638 19:3612169-3612191 CTTGTATCCCTGCACGATCTTGG + Exonic
1162728323 19:12702824-12702846 TGTGTTTTCCAGCAGTGTCTTGG + Exonic
926800940 2:16660076-16660098 TCTGCATCCCAGCTCTCTCTTGG + Intronic
929446533 2:42006085-42006107 TGTGCATCACAGCATTGTCTGGG - Intergenic
929851879 2:45598854-45598876 TGTCTGTCCCAGCACATTCTGGG - Intronic
934130303 2:88941669-88941691 TGTTCATCCCAACACCATCTAGG + Intergenic
935179754 2:100679012-100679034 TATTTATCCCATCACTATCCTGG + Intergenic
936344842 2:111667643-111667665 GGTGGATACCAGCCCTATCTAGG + Intergenic
937493037 2:122389568-122389590 TCTGTATCCCCACTCTATCTTGG - Intergenic
939766767 2:146260337-146260359 TGTGTCTCCTAGCACTACTTAGG + Intergenic
945435250 2:209810256-209810278 TGTATCTCCCAGAACTATTTTGG + Intronic
947678177 2:232004328-232004350 TGTTAATCCCAGCACTTTGTGGG - Intronic
948237590 2:236402142-236402164 GGTGTAACCCAGCACTGTCTTGG - Intronic
1174228750 20:49026496-49026518 TGAGAATCCCACCACCATCTTGG - Intronic
1174354450 20:49988710-49988732 TGTGTCTCCCAGAACTATTCTGG + Exonic
1175033214 20:55975264-55975286 TGCGTTTCCCAGCACTGCCTTGG - Intergenic
1176938588 21:14896810-14896832 TTTGTATTCCAGCACAAGCTGGG - Intergenic
1179566403 21:42251747-42251769 TGAGTCTCCCAGCTCTCTCTGGG - Intronic
1182395548 22:30033465-30033487 ATTGTATGCCAGCACTTTCTGGG - Intergenic
1182670000 22:31987733-31987755 TGCGTATTCCAGTACTATGTAGG - Intergenic
1183123336 22:35749934-35749956 TATCTATCCCAGCATTCTCTTGG + Intronic
1184453462 22:44596464-44596486 TGAGTATCCCAGGACTCTCCTGG - Intergenic
1185129269 22:49028423-49028445 TCTGTGTCCCAGCACTGTCTGGG + Intergenic
953024451 3:39136833-39136855 TGTATATCCCTGCCCTGTCTGGG + Intronic
955369066 3:58335131-58335153 TCTGTATACCAGCACTTTGTGGG - Intronic
957787861 3:84905065-84905087 TGTGTATCCCTGCACTTTGCGGG + Intergenic
963243805 3:143039729-143039751 TGTGTGTCCTAGCACAATATGGG + Intronic
963963417 3:151336240-151336262 TGTTTATCCCAGCAGTGTATAGG + Intronic
968664520 4:1813780-1813802 TGTGTATCGGAGCTCTTTCTCGG - Exonic
968982608 4:3858570-3858592 TGTGTGCTCCAGCACTGTCTGGG + Intergenic
971793054 4:31194068-31194090 GGTGTATTCCAACACTATTTAGG + Intergenic
972413253 4:38814105-38814127 TGTCTACCCCAGCACACTCTTGG - Intronic
972942090 4:44208313-44208335 TGTGTATCCTGGCACTATGAAGG + Intronic
974609229 4:64193514-64193536 GGTGCATCCCAGCTGTATCTAGG + Intergenic
976409263 4:84694385-84694407 TGTGTGTCCCAGAAATATGTTGG + Intronic
978069642 4:104451475-104451497 TGGGTATCTCAGTCCTATCTAGG - Intergenic
981573363 4:146176805-146176827 AGTTTATCAAAGCACTATCTGGG - Intronic
988052309 5:26046832-26046854 TGTGTATTTCAGCTCTGTCTTGG - Intergenic
998333408 5:141349457-141349479 TGTGTACCCCAACACTAAATTGG + Intronic
1000230907 5:159314185-159314207 TGTGTAACCCAGCACCATCCAGG - Intergenic
1003962366 6:11220612-11220634 TTTGGAACCCAGCACTATTTTGG + Intronic
1007270148 6:40630201-40630223 TGTGTGTCCCAGCAGTATCCTGG + Intergenic
1007692887 6:43714318-43714340 TGTATCTCCCAGAACTCTCTTGG + Intergenic
1007960179 6:45951675-45951697 GGTGAATCCCAGCACCGTCTTGG - Intronic
1010277267 6:73983917-73983939 TGTCTATCCCTGCACCATCTTGG + Intergenic
1010891063 6:81311351-81311373 TTTTTATTCCAGCAATATCTAGG + Intergenic
1010964735 6:82191839-82191861 TGTGGATCTCAGAACTATCATGG - Exonic
1017036390 6:150271060-150271082 TGTGTCTCCCTGCACTAGTTTGG + Intergenic
1019300713 7:302147-302169 TGTGTCTCCCAGCCCCAGCTGGG - Intergenic
1020364274 7:7363829-7363851 TCTGTTGCCCAGCACGATCTCGG + Intronic
1021587479 7:22224651-22224673 TATGTGTCCCACCACTGTCTGGG - Intronic
1027397934 7:77775476-77775498 TGTGAAACACAGCACGATCTCGG - Intronic
1027941867 7:84692398-84692420 TGTTTATCACAGCATTATTTAGG - Intergenic
1028738949 7:94250018-94250040 TGTTTATCCCAGCCTTTTCTTGG - Intergenic
1028842159 7:95440473-95440495 TGTGTATCCAAGCAGTTACTGGG + Intergenic
1029851776 7:103468832-103468854 TCTATATCCCAGCACTTTTTAGG - Intergenic
1031985934 7:128164726-128164748 TCTGTGGCCCAGCCCTATCTTGG - Intergenic
1033210524 7:139456979-139457001 TGTGTATCCCAGAAGTGTCACGG + Intronic
1037070910 8:14647914-14647936 TGGGTATTCCTCCACTATCTGGG + Intronic
1038027687 8:23606756-23606778 TGAGGATCACAGCACTATTTGGG - Intergenic
1044751940 8:95424554-95424576 TGTTTATCCCAGCATTATAATGG + Intergenic
1048147383 8:131858689-131858711 TGTGTGTGCCTGCACTATTTGGG - Intergenic
1049176284 8:141194522-141194544 TGTGGATTCCAGAACTTTCTAGG - Exonic
1050272828 9:3964081-3964103 TTTGCAGCCCAGCACTCTCTCGG - Intronic
1050722148 9:8602284-8602306 GGTGTATGCCAGCAATATCTAGG - Intronic
1051334260 9:16052420-16052442 TGTGTAACCCAGGGGTATCTTGG - Intronic
1052372386 9:27680011-27680033 TATGTATCTCATTACTATCTTGG + Intergenic
1052487678 9:29123546-29123568 TGTTTATCTCTTCACTATCTAGG - Intergenic
1056711805 9:88997711-88997733 TGGGTATCCCAGCAATCTGTAGG + Exonic
1057967969 9:99522906-99522928 ACTGTATACCAGCACTATTTTGG - Intergenic
1058541431 9:106016349-106016371 TGTGTGTCCCAGTGTTATCTTGG + Intergenic
1190905398 X:54722209-54722231 TGGTTTTCCCAGCACTGTCTTGG - Intergenic
1191016254 X:55813395-55813417 TGGGTATCCCTGCACTCTCAGGG + Intergenic
1194655688 X:96570531-96570553 TGGGCATCCCAGCACTGTCCAGG + Intergenic
1200799986 Y:7377669-7377691 TGTTTTTCCAAGCAATATCTGGG + Intergenic