ID: 1129933498

View in Genome Browser
Species Human (GRCh38)
Location 15:79431419-79431441
Sequence CTGGATACATGGATCAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129933498_1129933503 10 Left 1129933498 15:79431419-79431441 CCATTTCTGATCCATGTATCCAG No data
Right 1129933503 15:79431452-79431474 GAAACCCATCCCAGTTTCGTGGG No data
1129933498_1129933508 17 Left 1129933498 15:79431419-79431441 CCATTTCTGATCCATGTATCCAG No data
Right 1129933508 15:79431459-79431481 ATCCCAGTTTCGTGGGGTTTGGG No data
1129933498_1129933504 11 Left 1129933498 15:79431419-79431441 CCATTTCTGATCCATGTATCCAG No data
Right 1129933504 15:79431453-79431475 AAACCCATCCCAGTTTCGTGGGG No data
1129933498_1129933502 9 Left 1129933498 15:79431419-79431441 CCATTTCTGATCCATGTATCCAG No data
Right 1129933502 15:79431451-79431473 GGAAACCCATCCCAGTTTCGTGG No data
1129933498_1129933509 18 Left 1129933498 15:79431419-79431441 CCATTTCTGATCCATGTATCCAG No data
Right 1129933509 15:79431460-79431482 TCCCAGTTTCGTGGGGTTTGGGG No data
1129933498_1129933511 19 Left 1129933498 15:79431419-79431441 CCATTTCTGATCCATGTATCCAG No data
Right 1129933511 15:79431461-79431483 CCCAGTTTCGTGGGGTTTGGGGG No data
1129933498_1129933507 16 Left 1129933498 15:79431419-79431441 CCATTTCTGATCCATGTATCCAG No data
Right 1129933507 15:79431458-79431480 CATCCCAGTTTCGTGGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129933498 Original CRISPR CTGGATACATGGATCAGAAA TGG (reversed) Intergenic
No off target data available for this crispr