ID: 1129935028

View in Genome Browser
Species Human (GRCh38)
Location 15:79440217-79440239
Sequence AACAGCCTTGTAAAATATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129935028_1129935032 -4 Left 1129935028 15:79440217-79440239 CCCCCATATTTTACAAGGCTGTT 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1129935032 15:79440236-79440258 TGTTGTGAGTTTCCCGCATAAGG 0: 1
1: 0
2: 0
3: 0
4: 73
1129935028_1129935038 14 Left 1129935028 15:79440217-79440239 CCCCCATATTTTACAAGGCTGTT 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1129935038 15:79440254-79440276 TAAGGAGAAGATCTGGGGTTTGG 0: 1
1: 0
2: 1
3: 29
4: 359
1129935028_1129935035 8 Left 1129935028 15:79440217-79440239 CCCCCATATTTTACAAGGCTGTT 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1129935035 15:79440248-79440270 CCCGCATAAGGAGAAGATCTGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1129935028_1129935033 7 Left 1129935028 15:79440217-79440239 CCCCCATATTTTACAAGGCTGTT 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1129935033 15:79440247-79440269 TCCCGCATAAGGAGAAGATCTGG 0: 1
1: 0
2: 0
3: 4
4: 48
1129935028_1129935037 9 Left 1129935028 15:79440217-79440239 CCCCCATATTTTACAAGGCTGTT 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1129935037 15:79440249-79440271 CCGCATAAGGAGAAGATCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129935028 Original CRISPR AACAGCCTTGTAAAATATGG GGG (reversed) Intronic
904731789 1:32598187-32598209 TACAGTCTGGTAAAATATGTAGG - Intronic
905718941 1:40179139-40179161 AATAGCTTTTTTAAATATGGTGG - Intronic
906284464 1:44577669-44577691 AACAGCGTGGTAAAATACTGGGG + Intronic
910533566 1:88269719-88269741 AACAGCCCTTTAAAATAGGAAGG - Intergenic
911080041 1:93919599-93919621 AATAGCATTTTAAAATATAGGGG - Intergenic
913063456 1:115228583-115228605 AACAGGTTTGAAAAATATGTAGG - Intergenic
913280831 1:117183467-117183489 AACAGTCTTTTAAAAAATTGTGG + Intronic
913353783 1:117895222-117895244 AACAGCCTTTTAAAATAATTGGG - Intronic
915493645 1:156266048-156266070 ATCAGACTTGGAAGATATGGAGG - Exonic
915610251 1:156986220-156986242 ATCAGCCTTGTAGTAGATGGAGG + Intronic
917278973 1:173361169-173361191 AACTGCCTTTTAAAATAGGTGGG + Intergenic
918806890 1:189059489-189059511 AAGAGCATTGTAAAATCAGGTGG + Intergenic
918924959 1:190771616-190771638 AACAGCATATTAAAATATGAAGG + Intergenic
919740567 1:200979073-200979095 AAGAGCCTTGCAAAATAAAGTGG - Intronic
920543434 1:206796409-206796431 ACCAGCCTCGTAAAGAATGGAGG - Intergenic
921282911 1:213585133-213585155 AACAGCCTTGAAAATTAAGGAGG - Intergenic
921411593 1:214841848-214841870 AACAGCCTTGAGAAAAATTGTGG - Intergenic
1063479694 10:6364162-6364184 AAGACCATTGTAAAAGATGGGGG - Intergenic
1068326425 10:55493736-55493758 ACCTGCCTTATAAAATATGTTGG + Intronic
1068726756 10:60311752-60311774 AGCAGCCTTGAAAGATCTGGAGG - Intronic
1068881673 10:62055915-62055937 GACAGCATTGTAGAATATGTGGG + Intronic
1069737416 10:70666080-70666102 AACAGTTTTATAAAATAAGGAGG + Intergenic
1071160272 10:82737668-82737690 AACAGCCTTGTTAAGTGGGGAGG - Intronic
1071976948 10:90964769-90964791 AACTGCCTTGTAAACTATGGTGG - Intergenic
1072617849 10:97061346-97061368 AAGAGCCTTTGAAAAAATGGAGG + Intronic
1074175284 10:110994306-110994328 CACATCCTTGTAAAATGGGGAGG - Intronic
1074322862 10:112419827-112419849 AACAGTCTTATGAAATATTGGGG - Intronic
1074654679 10:115571424-115571446 AACAGCATCTCAAAATATGGGGG - Intronic
1076526275 10:131114321-131114343 TTCAGCTTTGTAAAATATGCTGG - Intronic
1077528689 11:3084709-3084731 GACAGATTTGGAAAATATGGGGG + Intergenic
1077741647 11:4852899-4852921 AACAGCATGGATAAATATGGAGG + Intronic
1080270513 11:30446563-30446585 AACAGCCTTGCAGAGCATGGAGG - Intronic
1082203636 11:49404610-49404632 AGCAGAAATGTAAAATATGGGGG + Intergenic
1085019342 11:73195420-73195442 GACAGCCCTGTAAAATATAAAGG + Intergenic
1085229699 11:74955124-74955146 AACAGGGATGTAAAATGTGGTGG + Intronic
1086046419 11:82537321-82537343 AAGGGCCTTATAAAATATGTGGG + Intergenic
1087256189 11:95957217-95957239 AACAGTCATGTAAATTACGGAGG - Intergenic
1088953745 11:114597727-114597749 AAATGCCTTTTAAAAAATGGAGG + Intergenic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1090561890 11:127941649-127941671 AACAATCTCGTAAAACATGGTGG - Intergenic
1091148590 11:133304067-133304089 AAGAGCCTTGTAAAATAGAAAGG - Intronic
1096604868 12:52757416-52757438 AACAGCCTTGGAAAAAATGAAGG - Intergenic
1097548586 12:61037242-61037264 ACCACCCTGGTACAATATGGAGG + Intergenic
1098713587 12:73800582-73800604 AACAGACTAGTAAAATATACTGG + Intergenic
1098813234 12:75122915-75122937 AATAGCCTTGTAAATTATCAAGG - Intronic
1098853909 12:75630485-75630507 AAGAGCCTTGGAAAATGGGGAGG + Intergenic
1100810984 12:98338177-98338199 AGCATCCTTCTAAATTATGGTGG + Intergenic
1101215125 12:102573702-102573724 AACAGCCTTGTAAAGTAGACTGG - Intergenic
1101469362 12:104982331-104982353 AGCAGTTTTGTAAAATATGAAGG - Intergenic
1102686301 12:114727420-114727442 AGCAGACTTGAAAAACATGGAGG - Intergenic
1103695469 12:122811955-122811977 ATAAGCCTTGAAAAATATGTGGG - Intronic
1105671100 13:22616906-22616928 AAAAGACATATAAAATATGGTGG - Intergenic
1105956129 13:25285284-25285306 AACAGACTTGGAAAATATTTAGG - Intronic
1107798245 13:44076812-44076834 AACAGCAGTTTAAAATAAGGCGG - Intergenic
1107804251 13:44139681-44139703 AACAACCTTGTGAAATAAGTGGG - Intergenic
1108192861 13:47960338-47960360 ACCAGCCATTTAAAATTTGGTGG + Intronic
1113219316 13:108080562-108080584 AGCAGGATTTTAAAATATGGTGG + Intergenic
1113894692 13:113756186-113756208 AAAAGACTTGTAAAAAAAGGGGG - Intergenic
1114515546 14:23297613-23297635 CCAAGCCTTGTAAAATAGGGAGG - Exonic
1114815928 14:25958089-25958111 AACAGTTGTGCAAAATATGGAGG + Intergenic
1115514201 14:34168790-34168812 AACGGCCTTGTAAAATAAGTGGG - Intronic
1116749482 14:48865313-48865335 AACTGCCTTGTATAATAGGAGGG + Intergenic
1117973839 14:61279556-61279578 AACATGCTTGTTAAATATGCAGG - Exonic
1118775503 14:68971613-68971635 AACAGCCTTGTAAGATATGTGGG - Intronic
1118923674 14:70172401-70172423 GACAGCTTAGTAAAATAGGGTGG - Intronic
1120814680 14:88843027-88843049 AACAGCCCTGGAAAATATCAAGG - Intronic
1121204978 14:92156771-92156793 AAGAGACTTGTGAAGTATGGTGG + Intronic
1123850118 15:24346693-24346715 AAAAACCTGGTAAAATATGAAGG + Intergenic
1123980121 15:25594452-25594474 AACATCCTTGTAAAATGAGCCGG - Intergenic
1127722835 15:61719670-61719692 AAAAGCCTTGTAAAAACTGCTGG + Intergenic
1129935028 15:79440217-79440239 AACAGCCTTGTAAAATATGGGGG - Intronic
1131223598 15:90605953-90605975 TACAGCCTTAAAAAACATGGAGG + Intronic
1132337881 15:101060487-101060509 AACAGCTTTTTAAAATTTGGTGG + Intronic
1137924868 16:52530879-52530901 TGCAGCCTTGAAAAACATGGAGG + Intronic
1138325313 16:56160882-56160904 AAAAGACTTGGAAAACATGGGGG - Intergenic
1140720438 16:77766712-77766734 AACAAACTTGTCACATATGGTGG + Intergenic
1142821839 17:2475168-2475190 AACAGGCTAGTAAAAGATGATGG + Intronic
1143274123 17:5697278-5697300 AACAGCCTTGGGAAATAGGCAGG + Intergenic
1143288156 17:5807541-5807563 AACTGCCTTGTAAAACAAGGAGG - Intronic
1144427975 17:15162549-15162571 AACATCCTTGCAAAATATTCTGG + Intergenic
1148672975 17:49426274-49426296 AACAGCTTTAAAAAATATGAAGG - Intronic
1148853931 17:50568365-50568387 AACAGCCCTGTGAAATATCTGGG - Intronic
1150667352 17:67154000-67154022 AAGAGCCTAGTAACAAATGGTGG - Intronic
1151935695 17:77259544-77259566 TACGGCCTGGGAAAATATGGAGG + Intergenic
1153602734 18:6797583-6797605 AACAGCTTTCTACAATTTGGAGG + Intronic
1153614889 18:6925287-6925309 AACAGCCTTGATAAATGTGTAGG + Intergenic
1155201177 18:23519215-23519237 AAAAGCCTTGTGAAAATTGGTGG + Intronic
1155288522 18:24317052-24317074 TACAGCCTTGTAAAATCTTGGGG - Intronic
1156997771 18:43488844-43488866 AAGAGCCTTGTAGAATTTGTTGG - Intergenic
1159688814 18:71459678-71459700 AATTGCCTTGTAACATATGCTGG + Intergenic
1160055799 18:75478998-75479020 AACAGCCTTGCAAATTAACGAGG - Intergenic
1165481318 19:36066127-36066149 AACAGCCCTGTAGCAGATGGGGG + Intronic
926800424 2:16655337-16655359 AACATACTTGTTAAAAATGGAGG + Intronic
926982545 2:18586756-18586778 TACAGTCTGGTAAAAAATGGTGG - Intronic
928785442 2:34879830-34879852 AACAGCATTGTAAAATTATGTGG + Intergenic
929120631 2:38481217-38481239 AAGAGCCTTCTGAAAAATGGAGG + Intergenic
930144813 2:47991192-47991214 CACAGCCTTGGTAAATAGGGAGG - Intergenic
932977086 2:76615796-76615818 CACAGACTTTTAAAATATGCAGG - Intergenic
933084716 2:78041401-78041423 AACAGCTTTGGAAAATTTGGTGG - Intergenic
933698895 2:85240271-85240293 AACAGCCTTGTGAGAGAGGGAGG - Intronic
935936366 2:108187902-108187924 AACATCCTTCAAAAACATGGAGG + Intergenic
937454003 2:122025771-122025793 AAGAGCCTGGTCAGATATGGAGG + Intergenic
939845913 2:147245916-147245938 AATAGCCTTGTAAATGAGGGAGG + Intergenic
940072931 2:149709745-149709767 AACAACCTTGTAATACATGATGG - Intergenic
940603706 2:155893032-155893054 TACAGCATAGTAAAAAATGGAGG - Intergenic
941444342 2:165582215-165582237 AACTACCTTGTAGAATGTGGTGG + Intronic
943007735 2:182406935-182406957 AACATCATTGAAAAATATGCAGG - Intronic
945851571 2:215014494-215014516 AAGGCCCTTGTAAAATTTGGGGG + Intronic
946436255 2:219657700-219657722 AACAGCCTTTTATAAAATGAGGG - Intergenic
947037727 2:225878629-225878651 AAAAGCGTAGTAAAATATTGTGG + Intergenic
948993937 2:241569070-241569092 CACAGCCTTGTAAACCTTGGTGG - Intronic
949081379 2:242103127-242103149 AACAGCCCAGTAAAAAATTGGGG + Intergenic
1170915469 20:20620165-20620187 AATAGACATGTAAAATATGATGG + Intronic
1170948819 20:20915651-20915673 AACATTCTTGAAAAATAAGGAGG + Intergenic
1173155175 20:40602464-40602486 AACAGCCTTTTGCAATTTGGGGG + Intergenic
1173457351 20:43214221-43214243 AAGAGCCTTGGAAAATAAGCTGG + Intergenic
1178079661 21:29050649-29050671 AACAGCAGTGTAAAATAGGATGG + Intronic
1182382933 22:29908116-29908138 AACAACCTTGTAAAACCTGGGGG + Intronic
1185415838 22:50709777-50709799 AAAAGCCTGGAAAATTATGGTGG - Intergenic
949699145 3:6735794-6735816 CACAGATTTGAAAAATATGGAGG - Intergenic
950351578 3:12359334-12359356 AACACACTAGTAAAATATGATGG + Intronic
950354398 3:12392971-12392993 AAGAGACTTGAAAAATCTGGGGG + Intronic
950776821 3:15357225-15357247 AACAGCCTTATAAAATCAGCAGG - Intergenic
951517321 3:23575076-23575098 AGCAGCCTTTTAACATGTGGTGG + Intronic
951587453 3:24229978-24230000 ACCAGCCTTGTGAAATAAGTGGG - Intronic
952104192 3:30050522-30050544 AACAGGCAGGTAAAATCTGGTGG - Intergenic
953888889 3:46736098-46736120 AAGAGCCTTATTAAAAATGGGGG - Intronic
954345321 3:49992358-49992380 AATAGCCATGTAATCTATGGAGG + Intronic
955346630 3:58166464-58166486 AACAGCTTGTTAAAAAATGGTGG + Intronic
955630809 3:60972540-60972562 AAAAGCCAAATAAAATATGGAGG - Intronic
956389979 3:68761485-68761507 AAAAGCCTTGCAAAATCTGAGGG + Intronic
957511741 3:81197757-81197779 AATGGGTTTGTAAAATATGGTGG + Intergenic
957521781 3:81327784-81327806 GACAGACTTGAAATATATGGAGG + Intergenic
958594731 3:96207265-96207287 AAAATCATTGTAAAATATTGAGG + Intergenic
960090873 3:113636926-113636948 AACAGCCCTGTGAAGTATGCAGG + Intergenic
961024664 3:123543776-123543798 ACCAGCATTGCAGAATATGGGGG + Intronic
965515690 3:169619093-169619115 AACTGGCCTGCAAAATATGGTGG + Intronic
966216591 3:177509192-177509214 AAAAGCCTTTTAAATTATTGAGG + Intergenic
967465313 3:189798242-189798264 AAGAGGCTTGTATAATATGTCGG - Intronic
967684435 3:192402962-192402984 AACAGCCTTGTTAGACATAGAGG - Intronic
972422802 4:38905440-38905462 AACAGCTTTGTAAGATTTGGTGG + Intronic
974281093 4:59794920-59794942 AACAGCCCTGGACAACATGGTGG + Intergenic
974568225 4:63607172-63607194 AACAGCAATGTAAACTATTGAGG - Intergenic
974921285 4:68242967-68242989 AACAGAATTAGAAAATATGGTGG + Intronic
974983015 4:68984895-68984917 ACAAGTCTTGTGAAATATGGAGG + Intergenic
975430382 4:74283200-74283222 AAGAGTCTTGTAAAATGTGCTGG - Intronic
979459415 4:120963944-120963966 AACAGCATTATAAAATGAGGAGG - Intergenic
982331006 4:154182140-154182162 AGCAGCATTTTAAAATATGTGGG + Intergenic
983987802 4:174081429-174081451 AATAGCCTTGAAGAATATAGTGG - Intergenic
985308500 4:188571479-188571501 TACAGCATTAAAAAATATGGTGG + Intergenic
988684198 5:33512186-33512208 AAAGGCCTTGATAAATATGGAGG + Intergenic
989281203 5:39645553-39645575 AGCTGCCTTGTAAAATATCCAGG - Intergenic
993041947 5:82824389-82824411 CAGAGCCTTGTTAAATAAGGAGG - Intergenic
993778776 5:92039029-92039051 AACTGACTTCTAAAATATGTGGG + Intergenic
995001639 5:107138457-107138479 TACAGCCTTGTAAAAAATGTAGG - Intergenic
995006599 5:107204106-107204128 ATCAGACTTTTAAAAAATGGGGG - Intergenic
996826609 5:127689186-127689208 AACAGCAGTGGAAAATATTGTGG + Intergenic
998593034 5:143498127-143498149 AACTGCCTTTTAAAATATGATGG - Intergenic
1002015041 5:176314426-176314448 AACAACCTTGTGAAATCTAGGGG + Intronic
1005229874 6:23687344-23687366 AACAGCCTTTTAAAAAATGCTGG + Intergenic
1009547487 6:65039245-65039267 AAAAGCCTTTTAAAAAATGATGG - Intronic
1011872005 6:91907202-91907224 AACAGCCTTGTATTAAATGAAGG - Intergenic
1014480187 6:121926667-121926689 AACAGCCTTACAAAATTTAGGGG - Intergenic
1014797556 6:125744196-125744218 AATAAGTTTGTAAAATATGGAGG + Intergenic
1015583091 6:134747746-134747768 AACAGCATTTTAAAAAATAGAGG + Intergenic
1015714613 6:136179644-136179666 AACAGTCTTTTAAAATGTGTGGG - Intronic
1015887904 6:137939396-137939418 ATCAGTAATGTAAAATATGGAGG - Intergenic
1015916706 6:138224931-138224953 TAAAGCTTTGTAAAATATGTGGG + Intronic
1016760014 6:147726557-147726579 AACAGCTTTGCAAAATGTGAGGG - Intronic
1017673696 6:156792990-156793012 CACAGTCTTGTAGAATGTGGGGG + Intronic
1018943139 6:168323738-168323760 GACACCCTTGAAAAATATGGTGG - Intergenic
1021739199 7:23668400-23668422 AAAAGCTTTGTAAAATAAGATGG + Intergenic
1022278880 7:28885124-28885146 ACTCGCCTTGTATAATATGGAGG - Intergenic
1024480722 7:49859350-49859372 AACAGCCTTGTTACCTAAGGAGG - Intronic
1026065361 7:67066938-67066960 AACAGACTCCTAAAAAATGGGGG - Intronic
1026711513 7:72744926-72744948 AACAGACTCCTAAAAAATGGGGG + Intronic
1033249860 7:139749116-139749138 AACATCCCTGTAAAAGAAGGCGG - Intronic
1035214955 7:157358557-157358579 AACAATCTCGTAAAACATGGTGG + Exonic
1038004386 8:23417476-23417498 AACAGCTTTGTGAGATATGTAGG - Intronic
1038124065 8:24651663-24651685 ACCAGCCTTGTAAACCAGGGTGG - Intergenic
1039032570 8:33326133-33326155 AACAGCCTTGAAATATATTGTGG - Intergenic
1040043953 8:42942390-42942412 AACAGCCATGTAACATAGGTTGG + Intronic
1040441244 8:47445104-47445126 AAAAGCATAGTAAAATAAGGTGG - Intronic
1041809525 8:61892039-61892061 CACAGCCTTTTAAGAAATGGTGG + Intergenic
1043180214 8:77079215-77079237 AACAGCCTTGGAAAATAATAAGG - Intergenic
1043527212 8:81110724-81110746 AGCTGCCTTGAAAAATATAGTGG + Intronic
1045315818 8:101042486-101042508 AACAGCCTCGTTAAAGATGAAGG - Intergenic
1045454241 8:102360223-102360245 AACAGGGTTGTAAAAAATGTTGG - Intronic
1046021959 8:108676038-108676060 AACACTCTTGTAAAAGGTGGAGG + Intronic
1047969743 8:130074590-130074612 AACAGCAATGCAAAAGATGGAGG + Intronic
1048476187 8:134744228-134744250 AACAGCCTGCAAAAAGATGGGGG - Intergenic
1048732758 8:137462070-137462092 AACAGCCCTGGAATATATAGTGG - Intergenic
1050483097 9:6106100-6106122 ACCAGCCTGATAAAATTTGGAGG - Intergenic
1050834541 9:10059406-10059428 AACTGCCTTGTAAAATAGAATGG - Intronic
1051523563 9:18017425-18017447 AACAGGCTTCTCAAATTTGGGGG - Intergenic
1052521754 9:29557058-29557080 AAAAGAATTGTAAAATATTGTGG - Intergenic
1052664032 9:31471685-31471707 AACATCCTTGTAAAACAAGCTGG - Intergenic
1052868997 9:33485041-33485063 TAGAGCCTTGTAATATATGTTGG - Intergenic
1055448751 9:76410849-76410871 AACAAAGTTGTAAAATATGTGGG - Intergenic
1056039308 9:82645541-82645563 AACAGCATGGCCAAATATGGTGG - Intergenic
1056687012 9:88775257-88775279 TACAGCCTTTTAAAATATGAAGG - Intergenic
1057110950 9:92470441-92470463 AATAGCCATGTAAAATGTAGTGG - Intronic
1059133952 9:111785151-111785173 AACAACCATGAAAAATATGGGGG - Intronic
1059240980 9:112805050-112805072 AACAGAGTTGTACAATAAGGGGG - Intronic
1060444462 9:123674918-123674940 AACAGAATTGTATAATATGTAGG - Intronic
1186389136 X:9141080-9141102 AACAGCTTTGGAAGATAAGGTGG + Intronic
1190639742 X:52472479-52472501 AACAGCATTTTAAAAAATGGAGG + Intergenic
1190846874 X:54201203-54201225 AAAAGCCATGAAAAATATGCTGG - Intronic
1191991388 X:67040383-67040405 ATCAGCAGTATAAAATATGGTGG - Intergenic
1193292034 X:79786181-79786203 CACAGCCTTCCAAAATCTGGAGG + Intergenic
1193706611 X:84827988-84828010 CAAAGCCATGTAAAATATGAAGG - Intergenic
1194961804 X:100244673-100244695 AACCGCCTTCTACAATGTGGAGG - Intergenic
1195002506 X:100655682-100655704 AACAGCCCTGTAAGGTATGCAGG - Intronic
1196268128 X:113677048-113677070 AAGATCCCTGTAAAATAAGGTGG - Intergenic
1201014331 Y:9583935-9583957 AACTGTTTTGTAAATTATGGGGG + Intergenic