ID: 1129937701

View in Genome Browser
Species Human (GRCh38)
Location 15:79464441-79464463
Sequence CCTCATTTGTAAACTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 3, 2: 20, 3: 92, 4: 562}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129937701_1129937708 15 Left 1129937701 15:79464441-79464463 CCATCTTCAGTTTACAAATGAGG 0: 1
1: 3
2: 20
3: 92
4: 562
Right 1129937708 15:79464479-79464501 GAAGCTCGATAATTTGCCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 142
1129937701_1129937704 -7 Left 1129937701 15:79464441-79464463 CCATCTTCAGTTTACAAATGAGG 0: 1
1: 3
2: 20
3: 92
4: 562
Right 1129937704 15:79464457-79464479 AATGAGGAAATCGAGGCCCCAGG 0: 1
1: 0
2: 7
3: 123
4: 643

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129937701 Original CRISPR CCTCATTTGTAAACTGAAGA TGG (reversed) Intronic
900848877 1:5126281-5126303 CCACCTTTGTAAACTTATGATGG + Intergenic
901716477 1:11159035-11159057 CCACCTTTGGAACCTGAAGATGG + Intronic
902244032 1:15107545-15107567 CCTCATTTGTAAAATGAGTATGG + Intronic
902319123 1:15647660-15647682 CCTTATTTGTAAATTTAAGAGGG - Intronic
902634845 1:17728551-17728573 CCTCCCTTGTAAAATGCAGAGGG - Intergenic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
902965750 1:20000469-20000491 CCTCATTTGTTAATTGCCGAGGG - Intergenic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903440087 1:23381213-23381235 CCTCTTTTAGAAACTGCAGAGGG - Exonic
903504576 1:23824441-23824463 GCTCATGTGTAAAATGAAGATGG - Intronic
903532321 1:24040982-24041004 ACTGAATTGTAAACTGAAAATGG + Intergenic
903624240 1:24719912-24719934 CCTCATCTGTAAAATAACGATGG - Intergenic
904203616 1:28838001-28838023 CCTCCTCTGTACACTGAGGATGG + Intronic
904219204 1:28951174-28951196 CATCCTTGGTAAATTGAAGAGGG - Intronic
904457596 1:30656990-30657012 CCTCATCTGTAAACTGGGGGTGG - Intergenic
904533581 1:31184376-31184398 CCACATTTGTTAAATGGAGAAGG + Intronic
904819254 1:33230185-33230207 CCTCACTTGTAAACTGGGAATGG + Intergenic
904917725 1:33982455-33982477 CCTCATTAGCAAACTGTGGAAGG + Intronic
905405195 1:37727697-37727719 CCTCAGCTGTAAGATGAAGATGG - Intronic
905444485 1:38017146-38017168 TTTCATTTGTAAAATGAATACGG - Intronic
905499373 1:38424780-38424802 CTCCATTTGTGAACTGAAGGAGG - Intergenic
905827090 1:41034074-41034096 CCTCATGTGCAAACTGGAGATGG - Intronic
905977947 1:42193292-42193314 CCCCATTTGTACAATAAAGAGGG - Intronic
906605314 1:47165720-47165742 CCTCATGTGTATACTTAAGAAGG + Intergenic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906664996 1:47615175-47615197 TCTCCTTTGTAAATTGAAAATGG - Intergenic
906799099 1:48720546-48720568 CCTCATTTGTGAAATGCAAATGG + Intronic
906899749 1:49821358-49821380 CTTCATCTGTAAAATTAAGATGG + Intronic
906978014 1:50596234-50596256 CATCATTTGTAAACAAAATACGG + Intronic
907090198 1:51716904-51716926 CCTCATCTATAAACTGAAGTGGG - Intronic
907289797 1:53406484-53406506 CCCCATGTGTAAAATGGAGATGG - Intergenic
908027295 1:59966430-59966452 CCTCATCTGTAAACTGGAAATGG - Intergenic
908714761 1:67057519-67057541 CCTCTTTTATAAAGTCAAGAGGG + Intergenic
908834469 1:68214655-68214677 ACTTATTTTTAAACTGAAGAAGG + Intronic
908921315 1:69196697-69196719 GCTCATCTTTAAATTGAAGATGG + Intergenic
909225904 1:73022523-73022545 TCTCATCTGTAAACTGAAGATGG - Intergenic
909363535 1:74793361-74793383 CCTCATTTGTAAATAGGAAATGG - Intergenic
909391852 1:75129136-75129158 TCTCATTTGTAAAATGAAGATGG - Intronic
910928398 1:92419150-92419172 TCTCATCTGTAAACTGGGGATGG + Intergenic
911012768 1:93298979-93299001 CCTCATTTATAAAATGAAAAAGG + Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911716136 1:101135126-101135148 ACTCAGTTGCAAACTGAACATGG + Intergenic
912516306 1:110218652-110218674 CTTCATTTATAAAGTGAAAAAGG - Intronic
913174584 1:116262342-116262364 CCTCATCTGTAAGGTGAAGGAGG + Intergenic
913441522 1:118903273-118903295 CCTCTTTTGCAAATTGATGATGG + Intronic
916404929 1:164488940-164488962 CTTCATCTGTAAAATGGAGAAGG - Intergenic
916540994 1:165753951-165753973 CTTCATTTGAAAACATAAGAGGG + Intronic
916578443 1:166087365-166087387 CCTCCTTTGCAAAATGGAGATGG - Intronic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
916806322 1:168264945-168264967 CCTCATCTGTTAACAGAAGGAGG + Intergenic
917231992 1:172847216-172847238 CCTCATTTGTTAAAGGGAGATGG - Intergenic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
918564131 1:185906855-185906877 CCTGATATGGAGACTGAAGAGGG - Intronic
919643033 1:200064173-200064195 CTTAACTTGTAAAGTGAAGACGG - Intronic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920095584 1:203484348-203484370 CCTCATCTGTAAAGTGAGAATGG + Intronic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920436032 1:205947791-205947813 CCTCATATGTAAAATGAGGGAGG - Intergenic
920458006 1:206115982-206116004 CCACATCTGGACACTGAAGAAGG + Exonic
920971397 1:210746334-210746356 CCTCATCTGTAAAATGAAAGGGG - Intronic
920987562 1:210904844-210904866 CCTCATCTGTAAAATGGAGGAGG - Intronic
921007426 1:211108357-211108379 CTTTAGTTGTAAACTGGAGAGGG + Intronic
921075306 1:211695841-211695863 CCTCATCTGTAAAATAGAGATGG - Intergenic
921419067 1:214924863-214924885 CCTCATTTGTATCCTGAAGATGG + Intergenic
921445438 1:215241793-215241815 CCTAATATGTAAAATGACGATGG + Intergenic
921504119 1:215945656-215945678 CTTCATTTGTATACTGACAATGG - Intronic
921545459 1:216469477-216469499 CTTCATTTGTAAAATGAAAGAGG + Intergenic
921575654 1:216831774-216831796 CCACATTTGAAAACCAAAGAAGG - Intronic
922147157 1:222958025-222958047 TCTCAATTAAAAACTGAAGAAGG - Intronic
922655609 1:227380068-227380090 GCTCATTAGTAGACTGAATATGG + Intergenic
923365046 1:233251465-233251487 CTTCCTGTGTCAACTGAAGAAGG - Intronic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
923714558 1:236413951-236413973 CCTCAATTGTAAACTGCAGGAGG + Intronic
923840286 1:237663602-237663624 TCTCATTTTTAAAATGAAGCTGG + Intronic
924207219 1:241725647-241725669 CCTCAGTTGTGAACTGGAGGAGG - Intronic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924515316 1:244760768-244760790 CTTCATTTGTAAAACAAAGATGG + Intergenic
924570471 1:245233714-245233736 TCTTATTTGTAAACTTAACATGG + Intronic
1063371796 10:5527019-5527041 CCTCGTTTGTAAGATGAGGAAGG - Intergenic
1063693539 10:8310350-8310372 GACCATTTGTCAACTGAAGATGG + Intergenic
1065722568 10:28640973-28640995 TCTCATTTGTAAAATGCAGATGG + Intergenic
1065825184 10:29564226-29564248 CCGGATCTGTAAACTGAGGATGG - Intronic
1065952222 10:30662684-30662706 CCAGATCTGTAAACTGAGGATGG + Intergenic
1065963057 10:30749977-30749999 CCTCACCTGTAAAAAGAAGAAGG - Intergenic
1067676800 10:48387542-48387564 CCTCATTTTTAAACTGCTTATGG + Intronic
1067966519 10:50919324-50919346 CCTCAATTCAAATCTGAAGAAGG - Intergenic
1068528770 10:58161777-58161799 CCTCATTTGTAAAATGAAGGGGG - Intergenic
1070739281 10:78892106-78892128 CCTCTTCTGAAAACTGAAGCGGG - Intergenic
1071262276 10:83931481-83931503 CCTCATTTGTAAACTGGGAGTGG - Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071393298 10:85196663-85196685 CTTCACTTGCAAATTGAAGATGG + Intergenic
1072772178 10:98151359-98151381 CCTCATTTGTAAAATGGAGGTGG + Intronic
1073069765 10:100785923-100785945 TCTCCTCTGTAAAATGAAGATGG + Intronic
1073189290 10:101639307-101639329 CCTCCTTTGTAAGCTGTTGATGG - Intronic
1073666841 10:105543316-105543338 CCTCATTTCTAAAATACAGATGG - Intergenic
1073913708 10:108377443-108377465 TCTTAATTGTAAAATGAAGATGG + Intergenic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1074947920 10:118299113-118299135 CCCCATTTGGAAGCTGAAAAAGG - Exonic
1075275114 10:121086215-121086237 TCTCATTTGTAAAATGAAGTTGG - Intergenic
1075406348 10:122198322-122198344 CCTTATCTGTGAAATGAAGAGGG + Intronic
1075536959 10:123279280-123279302 CCTCATCTGTGAACTGTGGAAGG + Intergenic
1076111261 10:127861446-127861468 CCTCATCTGTAAAATGGAGTGGG - Intergenic
1076861902 10:133141726-133141748 CCTCATCTGAACACTGCAGAGGG - Intergenic
1077540814 11:3145717-3145739 TCTCATCTGTAAACTGCACAGGG - Intronic
1077889056 11:6405643-6405665 CGTCATTTGGAAGCTGAGGATGG - Intronic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078583175 11:12556222-12556244 CCCCATTTCTAAAAGGAAGACGG - Intergenic
1078700346 11:13674446-13674468 CCTCATCTGTAAAATGGAGGGGG + Intronic
1079576589 11:22011108-22011130 CCTCATTTATAAAATGAGAATGG + Intergenic
1079989140 11:27228950-27228972 TCTCATTTGGAAAATGAAGGGGG - Intergenic
1080680374 11:34470104-34470126 CCTCATTTGTTATCTAAAGTGGG - Intronic
1081658600 11:44874169-44874191 CCTCATCTGTAAAAAGGAGATGG + Intronic
1082294505 11:50422646-50422668 CCTCAGTTGTAAAAAGAATATGG + Intergenic
1083313794 11:61801802-61801824 CCTCATTTGCAAACCTCAGAGGG - Exonic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1084620013 11:70263351-70263373 CCTCATTTGTAAAGCAAAGATGG - Intergenic
1084757591 11:71249531-71249553 CCTGCTTTGTAAACTCAAGCCGG - Intronic
1085569431 11:77546461-77546483 CCTCCTTTGTAAAGTGGAGATGG + Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1086044983 11:82522156-82522178 CCACATATGTAAAATGTAGATGG - Intergenic
1086052058 11:82603893-82603915 CCTCATTTAAAAACAGAAGGAGG + Intergenic
1086116045 11:83251472-83251494 CTTCATTTATAAAATGAAGATGG - Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086351319 11:85944959-85944981 CCTCATCTGTCAACAGAAGGAGG - Intergenic
1086432670 11:86750349-86750371 CCTCAAGTGTACAGTGAAGAGGG - Intergenic
1087595121 11:100243822-100243844 GCTAATTTGGAGACTGAAGAGGG - Intronic
1087912189 11:103767157-103767179 CTAGATTTCTAAACTGAAGAGGG + Intergenic
1088442513 11:109887309-109887331 CTTCATTTGTAAAATAAAAATGG + Intergenic
1088916497 11:114231894-114231916 CCTCAACAGTAAAATGAAGAGGG - Intronic
1089064037 11:115648842-115648864 CCTCGTCTGTGAACTGAGGAGGG - Intergenic
1089343396 11:117774854-117774876 CCTCTTCTGTAAAGTGGAGAGGG + Intronic
1089350454 11:117818998-117819020 CCCCTTCTGTAAATTGAAGACGG + Intronic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1090031216 11:123208115-123208137 CCTCATTTTACAAGTGAAGAAGG - Intergenic
1090203890 11:124874554-124874576 CCTCATCTCTAAGATGAAGATGG - Intronic
1091341910 11:134822701-134822723 CCTCATCTATAAAGTGAGGATGG - Intergenic
1091578120 12:1758440-1758462 CCTCACTGGTAAATTGAGGAAGG - Intronic
1092078673 12:5694585-5694607 CCCCATGTATAAAATGAAGAGGG + Intronic
1093673540 12:21905815-21905837 CTTCATCAGTAAAATGAAGATGG - Intronic
1093973499 12:25396246-25396268 TCTCATTTGAAAACTGCAGATGG + Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1095481358 12:42639278-42639300 CCCTATTTGTAAAATGAGGAGGG - Intergenic
1095850154 12:46793923-46793945 CCTCAATTGTATAGTGAAAAGGG + Intronic
1096382952 12:51174046-51174068 CCTCGTTTGTAAACGGGAGTGGG + Intergenic
1097545261 12:60991774-60991796 TCTCATTTTAAAGCTGAAGAAGG + Intergenic
1097849623 12:64398830-64398852 CCTCATCTGTAAATTTAAAATGG + Intergenic
1098133938 12:67381702-67381724 CCTCATCTGTAGACTGGAGATGG - Intergenic
1098491107 12:71079927-71079949 CTTCATTTGTAAAATAGAGATGG + Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1099368005 12:81793411-81793433 CCTACTTTGTAAACACAAGATGG + Intergenic
1099483975 12:83204843-83204865 TCTAATTTATAAACTGAACATGG + Intergenic
1099849156 12:88070348-88070370 CATTATTTGAAACCTGAAGATGG + Intronic
1100215559 12:92444643-92444665 CCTCATTTGTAAAGCAGAGATGG - Intergenic
1100289953 12:93204240-93204262 CCTCATCTGTAAAACTAAGATGG + Intergenic
1101002546 12:100371228-100371250 CCTCATTTATGAAAGGAAGATGG - Intronic
1101169766 12:102078632-102078654 TCTCATTTCTAAAATGGAGATGG + Intronic
1101223451 12:102664424-102664446 CCTCATTTGTTAATTGCCGAGGG + Intergenic
1101330766 12:103755922-103755944 CCTCATCTATAAAATGGAGATGG + Intronic
1101349859 12:103919404-103919426 GCTCATTTGTTAGCTGGAGAAGG + Intergenic
1101876631 12:108600336-108600358 CCTCCTCTGTAAAATGGAGATGG + Intergenic
1101924800 12:108962603-108962625 CCACATTTTTAAAGTAAAGAGGG + Intronic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102738025 12:115180415-115180437 CCTCACTTGTAAACTGAGGATGG + Intergenic
1103517363 12:121515982-121516004 CCTCTTTTTTAAACTCCAGAGGG - Intronic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1106074426 13:26445450-26445472 CCTCATTTATAAAATGGAGATGG + Intergenic
1106137297 13:26983284-26983306 AGTCATTTGTAACCTGCAGATGG - Intergenic
1107422667 13:40263379-40263401 CCTCATTTGAAAAATGGAAATGG + Intergenic
1108705287 13:52979941-52979963 CCTTATTTGCAAAATGTAGATGG + Intergenic
1109376099 13:61495266-61495288 CCTTATCTGTAAAATAAAGATGG - Intergenic
1109862170 13:68214238-68214260 CTTCATCTGTAAAATGAAGTGGG + Intergenic
1109973354 13:69799558-69799580 TCTAATTTGAAAAATGAAGATGG - Intronic
1111377368 13:87398206-87398228 CCTCTATTGTAAAGTGAAAATGG + Intergenic
1111587067 13:90294389-90294411 TCTCATTTGTAAACTGATGAGGG - Intergenic
1112202245 13:97288376-97288398 CCTCATTTGCTAACAGAAAATGG - Intronic
1112373758 13:98819548-98819570 CCACATTTGCAAAATGAAGTAGG + Intronic
1113333200 13:109352173-109352195 ACTCATCTGTAAAATGGAGATGG - Intergenic
1113482960 13:110635047-110635069 CCTCATCTGTAATGTGATGATGG + Intronic
1116425349 14:44783808-44783830 CAGCATTTGTAAACAAAAGAAGG + Intergenic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1116853935 14:49935508-49935530 CTCCATCTGTAAAATGAAGATGG + Intergenic
1117411334 14:55454045-55454067 TGTCATTTGGGAACTGAAGATGG - Intronic
1117433123 14:55690024-55690046 TCTTATTTTTTAACTGAAGAGGG - Intronic
1118055887 14:62079432-62079454 CCTCAACTGTAAAATGGAGATGG - Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118349954 14:64966666-64966688 CTGCATCTGTAAATTGAAGATGG - Intronic
1118584188 14:67336695-67336717 CCTCATCTGCAAAGTGGAGATGG + Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1118599371 14:67460968-67460990 TCTCATCTGTAAAATGGAGATGG - Intronic
1118743703 14:68759068-68759090 CTTCATGTGTAAAATGCAGAGGG - Intergenic
1119317696 14:73709273-73709295 CCCCATGTTTAAACTGTAGAAGG + Intergenic
1119590548 14:75883453-75883475 CCCCAAGTTTAAACTGAAGAAGG - Intronic
1119984140 14:79116562-79116584 CCTTGTTTTTAAAATGAAGAAGG - Intronic
1120095526 14:80383759-80383781 CCTCATCTGTAACCTGGTGATGG - Intronic
1120983301 14:90310382-90310404 CCTCATTTGTAAAATGAAGAGGG + Intronic
1121916198 14:97838649-97838671 TTTCATTTGTAAAATGATGAAGG + Intergenic
1122506783 14:102236652-102236674 CCTCTTTTGTAAACCCAACAGGG + Intronic
1123800503 15:23814853-23814875 CCTCATTTGCTAAATGGAGATGG + Intergenic
1124641205 15:31397633-31397655 CCCCATCTATAAAATGAAGATGG + Intronic
1124841094 15:33242923-33242945 CCTCATTTGTAAAATGGAGAGGG - Intergenic
1125350842 15:38766024-38766046 TCTCATTTCTAAATTGAAAAAGG + Intergenic
1125448679 15:39785074-39785096 CTTCATTTGAAAAATGAAGTTGG + Intergenic
1126567155 15:50112675-50112697 CCACATCTGTAAAGTGGAGATGG + Intronic
1127709105 15:61577990-61578012 CCTCATCTGTAAAATGGAGGTGG + Intergenic
1127938665 15:63670320-63670342 CCACATTTCTCAACTGAAGAGGG - Intronic
1127988344 15:64092999-64093021 CCTCATTTGTACAATAAAGATGG + Intronic
1128078860 15:64844364-64844386 CCTCCTTTGTAAAAGGAAAAGGG + Intronic
1128418509 15:67469273-67469295 CCTCATTTCTAAAATAAAGGAGG + Intronic
1128429574 15:67578095-67578117 ACTCATTTGTAAAATCAAGACGG - Intronic
1128765339 15:70247920-70247942 CCTCACCTGTAAACAGAGGAGGG - Intergenic
1128787419 15:70408247-70408269 CCTCATTAATAAAATGCAGATGG + Intergenic
1128812777 15:70584789-70584811 CCCCATCTGTTAAGTGAAGAGGG - Intergenic
1128911258 15:71517555-71517577 TCTCATTTGTAATGTGAATAAGG + Intronic
1129937701 15:79464441-79464463 CCTCATTTGTAAACTGAAGATGG - Intronic
1130977575 15:88789172-88789194 CCTCCTTTGCCAAATGAAGAAGG + Intergenic
1131291135 15:91107976-91107998 CCTCAGTTGTAAGGTGATGATGG + Intronic
1131533780 15:93216695-93216717 CTTCATTTGTAAAGTGAAGATGG + Intergenic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133485159 16:6212834-6212856 CCCTATTTGTAACCTGAAAAAGG + Intronic
1133606724 16:7394651-7394673 CCTGATCAGTAAACTGAAAAGGG - Intronic
1133862598 16:9610199-9610221 CCTCATCTGTTAAATGGAGATGG + Intergenic
1134435122 16:14249625-14249647 CCTCATCTTTAAAATGAAGTTGG + Intronic
1134483393 16:14637460-14637482 TCTCATCTGTAAAATGAACATGG + Intronic
1135160156 16:20087199-20087221 CCTCATCTGTAACATGGAGAAGG - Intergenic
1135256117 16:20942745-20942767 CTTCATTTGTAGACTTAGGAGGG + Intronic
1135575263 16:23580982-23581004 CATCATTGAAAAACTGAAGATGG + Intronic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1137456416 16:48621347-48621369 CCTCTTCTGTAAATTAAAGAAGG - Intergenic
1137586854 16:49668884-49668906 CCTCAACTATAAAATGAAGATGG + Intronic
1137605935 16:49786775-49786797 CCTCATCTGTCAAATGAGGATGG + Intronic
1137706326 16:50538378-50538400 CCTCATCTGTGAAGTGGAGATGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138537537 16:57667901-57667923 CCTCCTCTGTAAAGTGAAGATGG - Intergenic
1138855143 16:60681697-60681719 CCTCCTCTGTAAAATGAAGCAGG + Intergenic
1139375563 16:66494380-66494402 CCTCATCTGTAAAGTGACTATGG + Intronic
1139824348 16:69745336-69745358 CCCCATCTGTAAAATGGAGACGG - Intronic
1140071134 16:71650834-71650856 CTTCATCTGTAAAATGAAAATGG + Intronic
1141212981 16:81998199-81998221 CTTCATTTTTAAACTAAAAATGG + Exonic
1141271635 16:82546266-82546288 CCTGATCTGTAAAATCAAGATGG - Intergenic
1141292542 16:82733589-82733611 TCTCATTTGTAAGATGAAGATGG - Intronic
1141875466 16:86821082-86821104 CCTCAAATGTAAACTAAGGATGG + Intergenic
1141989163 16:87600701-87600723 TCTCATCTGTAAAATGGAGATGG - Intergenic
1142895187 17:2971664-2971686 CCTCATCTGTGAAATGATGATGG + Intronic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144995355 17:19264516-19264538 CCTCATTTGTAAAATGGAAATGG - Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146176903 17:30670943-30670965 CCTCATTTATAAAATGAGGATGG + Intergenic
1146350363 17:32087043-32087065 CCTCATTTATAAAATGAAGATGG + Intergenic
1146360472 17:32171794-32171816 CAACATTTGTAAAATGAAGCAGG - Intronic
1147493550 17:40894336-40894358 TTTCATTTGTAAAATGAGGATGG - Intergenic
1147999188 17:44377757-44377779 ACTCATCTGTAATCAGAAGAAGG - Exonic
1148543131 17:48495767-48495789 CCTCATTTGTAAAAAGAAAGGGG + Intergenic
1148588060 17:48794942-48794964 CCTCATCTGTAAGATGGAGATGG + Intronic
1148834391 17:50458186-50458208 CATCATTTATGAAGTGAAGAGGG - Intronic
1148859865 17:50599191-50599213 CCTCATCTGTAAACTAGATATGG - Intronic
1148934585 17:51154691-51154713 CCTCATTTGTAAAATGAAGGGGG + Intronic
1148964692 17:51425086-51425108 TCTCATTGGTAAAATGTAGATGG + Intergenic
1149346475 17:55741568-55741590 CCTCATCTGTAAAATGAAAGTGG + Intergenic
1149865195 17:60147717-60147739 CCTCATCTATAAACTGGAGATGG - Intergenic
1149922692 17:60674218-60674240 CATCCTTTGTAAATTGTAGAAGG - Intergenic
1149990009 17:61377814-61377836 CCTCCTTTGTAAACTGGAGAGGG - Intronic
1150714603 17:67561007-67561029 AGACATTTGTAAACTGCAGAAGG - Intronic
1151340417 17:73467393-73467415 CCTCATCTGTAACATGGAGATGG + Intronic
1153484990 18:5588620-5588642 TCTCATTTGAAAAATGAACATGG - Intronic
1153513917 18:5887236-5887258 CCTCATTTATAAATTAAAGGTGG + Exonic
1153598083 18:6749475-6749497 CCTTATTTTTCAAATGAAGAAGG + Intronic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1153736443 18:8073929-8073951 CCTCATTCCTAAAATGAAGTTGG - Intronic
1154179918 18:12127191-12127213 CCTCATTTTTAGACTAATGAGGG + Intronic
1155297646 18:24399679-24399701 TTTCATTTGCAAACTGTAGAAGG - Intergenic
1155579489 18:27287013-27287035 CCTCATTTATAAAATGAGAATGG - Intergenic
1155967454 18:32049346-32049368 CATCATTTGTAAAATGGGGATGG + Intronic
1156190923 18:34719425-34719447 CTTCATCTGTAAAATAAAGATGG - Intronic
1156348587 18:36283136-36283158 CCTCATTTCTAAAATGGAGATGG - Intergenic
1156894192 18:42226080-42226102 CCATATATGTAAACTGAAGAGGG - Intergenic
1157185312 18:45535495-45535517 CCTCATCTGTAAGATGAGGATGG - Intronic
1157796766 18:50582043-50582065 TCTCATATGTAAAGTGGAGAGGG + Intronic
1157895401 18:51461824-51461846 ACTCTTTTGCAAACTGAAAAAGG - Intergenic
1158479088 18:57804459-57804481 CCTCATTTGTAAAATGAGATTGG + Intergenic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1160056189 18:75483262-75483284 GCTCATTAGTAGACTGAACATGG + Intergenic
1160117968 18:76099810-76099832 CCTCATCTGTACAGTGAAGAGGG + Intergenic
1162981916 19:14245967-14245989 CCTCATTTATAAAATGAGGATGG - Intergenic
1164115400 19:22214726-22214748 CTTAATTTGTAACATGAAGATGG - Intergenic
1165275721 19:34749511-34749533 CCTAAAGTGAAAACTGAAGAAGG - Intergenic
1166097921 19:40553055-40553077 TCTCATCTGTAAAATGGAGATGG + Intronic
1166276004 19:41754495-41754517 CCTGATTTGTAAAAGGAGGATGG - Intronic
1166281255 19:41795539-41795561 CCTGATTTGTAAAAGGAGGATGG - Intergenic
1166412214 19:42563141-42563163 CCTGATTTGTAAAAGGAGGATGG + Intergenic
1166730055 19:45054087-45054109 CCTCATTTGGAAAATGACAATGG - Intronic
1167095347 19:47372502-47372524 CCCCATTTGTAGATTGGAGATGG - Intronic
1167573507 19:50305577-50305599 CCTCATTTGTATAATGGAGCAGG - Intronic
1168318200 19:55493462-55493484 CCTCATTTGGATAGTGAAGATGG + Intronic
1168492289 19:56821160-56821182 CCTCATCTGTAAAATGAATATGG - Intronic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
926725992 2:15998412-15998434 CCTCAACTGTAAAATGGAGATGG - Intergenic
926737730 2:16086621-16086643 CCACATCTGTCAAATGAAGAGGG - Intergenic
928023301 2:27720746-27720768 ACTATTTTGTAAACTGAAAAAGG - Intergenic
928200399 2:29244279-29244301 CCTCATTTGTGAAATCAGGATGG + Intronic
928201498 2:29250295-29250317 CCTCATTTGTAAAACGAGGATGG + Intronic
928253972 2:29706118-29706140 CCTCATCTGTAAAATGGAGTGGG + Intronic
928420104 2:31131768-31131790 GGTCATTTATAAACTGAACAGGG - Intronic
928498824 2:31865361-31865383 TCTCATTTGTAAAATGTGGAGGG - Exonic
928540188 2:32277515-32277537 CCTCACCTGTAAGATGAAGAGGG - Intergenic
928649379 2:33388469-33388491 CCTCACTGGTAAAATGGAGATGG + Intronic
928824473 2:35403130-35403152 CCTCATTTGAAAACGGGTGAGGG + Intergenic
929024821 2:37589961-37589983 CCTCATTTTTAAAATGAGAACGG - Intergenic
929697018 2:44126366-44126388 CCTCATTCATAAAATGAGGATGG - Intergenic
929870942 2:45758867-45758889 CCTCACCTGTAAAGTGCAGAGGG + Intronic
929954104 2:46442484-46442506 GCTCATGTGTAAACTGGGGATGG + Intronic
930854303 2:55996137-55996159 AGTCATTTGTGAACTGAAGAAGG + Intergenic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931753470 2:65350947-65350969 CCTCCTTTGCAAAATGAATAGGG + Intronic
931989099 2:67771639-67771661 CCTCATCTGTCAAATGGAGATGG - Intergenic
932043351 2:68322308-68322330 CTTCATTTGTAAAATGATGATGG + Intergenic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932516687 2:72358332-72358354 CCTCATTTATAAAATGAGAAAGG - Intronic
933229913 2:79794852-79794874 TCTCAATGGTCAACTGAAGAGGG - Intronic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
935555661 2:104507215-104507237 CCTCGTCTGTAAAATGGAGATGG - Intergenic
935619935 2:105120244-105120266 CCTCTTTTGTAAAATGAATTAGG + Intergenic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937342201 2:121098482-121098504 CCCCATCTGTAAAATGGAGATGG + Intergenic
937460129 2:122078348-122078370 TCCCATTTGAAAATTGAAGAGGG - Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
938154131 2:128915383-128915405 CCCCATTTCTCAACTTAAGAAGG + Intergenic
939775859 2:146387175-146387197 CCTCCTTTTTCACCTGAAGAAGG - Intergenic
939897041 2:147804525-147804547 TTTCATTTGTAAACTACAGAAGG + Intergenic
939996600 2:148926125-148926147 CCCCAATTCTAATCTGAAGATGG + Intronic
940512580 2:154637320-154637342 CCTAATATGTTAACTGAAGGTGG + Intergenic
940969467 2:159879762-159879784 CCTCACGTGTAAAATGATGATGG + Intronic
941730152 2:168908534-168908556 CCTCATCTGAAAACTGAAACTGG - Intronic
941907818 2:170734077-170734099 CCTTATCTGAAAACTGAGGAAGG + Intergenic
942163693 2:173219757-173219779 CCTAATTTTTAAAGTGAAGTTGG - Intronic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
943235949 2:185319764-185319786 CCTTATCTGCAAATTGAAGATGG + Intergenic
943984242 2:194599382-194599404 TCTAATATGTAAAATGAAGATGG - Intergenic
944259231 2:197657957-197657979 TCACATCTCTAAACTGAAGAAGG - Intronic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944621236 2:201517737-201517759 CCTCACTTGTAAAATGGAAATGG - Intronic
944633062 2:201647194-201647216 TCTCATCTGTAAAATGATGATGG - Intronic
944635945 2:201676255-201676277 CCTCATTTCTAAAGTGAGGAAGG - Intronic
944779642 2:203004524-203004546 GCTCATTAGTAAACTGGACATGG + Intronic
945112062 2:206369340-206369362 CCTCATTTGTGAAATGAGGAAGG + Intergenic
945420932 2:209635352-209635374 ACTCATTTTTGTACTGAAGAAGG + Intronic
945689536 2:213016232-213016254 TCTCATCTGTACAGTGAAGATGG - Intronic
946109778 2:217404492-217404514 TCTCATTTGTAAAATGAAGGTGG - Intronic
946326610 2:218987744-218987766 CCTCATTTGTAAAGTGGGTATGG + Intergenic
946465860 2:219911518-219911540 CCTCATTTGCAAAATAAAGATGG + Intergenic
947174289 2:227347263-227347285 CCCCATATGTTACCTGAAGATGG + Exonic
948033325 2:234837482-234837504 CCTCATCTGTAAAATGCAGAGGG - Intergenic
948404669 2:237708234-237708256 CCTCATATTTAAACTGGGGATGG + Intronic
948685352 2:239666432-239666454 CCCCATTTGTAGAATGACGATGG + Intergenic
948741630 2:240051268-240051290 TGTCATCTGTAAACTGAAGCTGG - Intergenic
1168797274 20:620039-620061 CCTCATCTGTAAAATGAACTTGG - Intergenic
1168910787 20:1445123-1445145 CCCCATCTTTAAAATGAAGAAGG + Intronic
1169186566 20:3622294-3622316 CTTCAGTTATCAACTGAAGAAGG - Intronic
1169213727 20:3781989-3782011 CCTCCTTTGTGAAATGACGATGG + Intergenic
1169283747 20:4289931-4289953 CCTCATTTGTAAAGTGAGTCAGG - Intergenic
1169488302 20:6051901-6051923 CCTCATATGTAAAAAGGAGATGG + Intronic
1169507440 20:6227094-6227116 CCTGATATGAAAACTGAAGTCGG - Intergenic
1169633068 20:7655423-7655445 CTTCATATGTAAACAGAAGCAGG + Intergenic
1171424168 20:25039172-25039194 CCTCATCAGGAAAGTGAAGAAGG - Intronic
1172046819 20:32086357-32086379 CCTCATCTGTAAAGTGGAAATGG - Intronic
1172131563 20:32659495-32659517 GCTCATCTGTACAATGAAGATGG - Intergenic
1173084834 20:39905804-39905826 CCTCATTTGTAACATGGAGGGGG - Intergenic
1173219617 20:41121270-41121292 CCTCTTTAGGAAACTGAAGCAGG - Intronic
1173618702 20:44420001-44420023 CCTCATCTGTTAAATGAAAACGG - Intronic
1173644009 20:44622427-44622449 CCTCATTTGTAAGATGAGGACGG + Intronic
1173958621 20:47053979-47054001 CCCCATTTGTAAAATGGGGATGG + Intronic
1173997929 20:47353745-47353767 CCACGTTTGTAAATTGCAGAAGG - Intronic
1174292842 20:49521204-49521226 ACTCATCTGTAAAATGGAGATGG - Intronic
1175015135 20:55781720-55781742 GCTCATTTGTAAACTACAGGGGG - Intergenic
1176922123 21:14700315-14700337 CCTGATAAGTAAACTGAAGTTGG - Intergenic
1177345612 21:19864846-19864868 CGTCATTTGTACAATGTAGAGGG + Intergenic
1177647232 21:23914878-23914900 CCTCATTGGTAGAATGGAGATGG - Intergenic
1178235597 21:30837505-30837527 CCTCATGTATAAAATGAAGAGGG - Intergenic
1178303891 21:31474427-31474449 CCTCATCTGTAAGATGAGGATGG + Intronic
1178561978 21:33646619-33646641 CCTCATTTCTCAGCTGAACATGG + Intronic
1179511608 21:41877475-41877497 CCTCATTTGCAAAGTGTGGATGG - Intronic
1180566721 22:16674288-16674310 CCTCATTTTTAGACTAATGAGGG - Intergenic
1181727723 22:24823128-24823150 CCTCATCTGTAAAGTAAAGAGGG + Intronic
1181997180 22:26892215-26892237 CCTCATCTGTAAAGTGGAGATGG - Intergenic
1182052093 22:27321140-27321162 CCTCATCTGTAAAATGGAAATGG + Intergenic
1182086381 22:27563917-27563939 CCCCATCTGTAAAATGAAGAGGG + Intergenic
1182093789 22:27613134-27613156 CCTCATTTGTCAAGTGAGCATGG + Intergenic
1182223688 22:28778726-28778748 CTCCATTTGTAAATTAAAGATGG - Intronic
1182684212 22:32108711-32108733 CTTCATTAGTACAATGAAGAAGG + Intronic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183705082 22:39471056-39471078 CCTCCTTTGTTATCTGACGATGG + Intronic
1184316656 22:43698483-43698505 GCTCATTTGTTGAGTGAAGAAGG + Intronic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
949807279 3:7969623-7969645 CCTCCTCTGTAAAATGAAGGTGG - Intergenic
949934132 3:9103460-9103482 CCTCATTTGTGAAATGGTGATGG - Intronic
950099665 3:10349060-10349082 CCTCATTTGTAAAATGGCTATGG - Intronic
950189606 3:10967416-10967438 CCTCATCTGTGAAATGCAGACGG - Intergenic
950222143 3:11204721-11204743 TCTCATTTGTAAATTGGAGATGG - Intronic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
951507188 3:23460418-23460440 CCTCATATGTAAAATGGAAATGG + Intronic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
953005725 3:38977423-38977445 CTTCATTTGTAAGTTGTAGATGG + Intergenic
953529724 3:43729456-43729478 TCTCTTTGGTAAAATGAAGATGG - Intronic
953547955 3:43878041-43878063 CCTCACTTTTAAACAGAAGGTGG - Intergenic
954423740 3:50432431-50432453 CCACATTTGTAAACTGGACAGGG + Intronic
954619839 3:51989243-51989265 CCTCATCTGTGAAATGGAGATGG - Intergenic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
954707758 3:52490065-52490087 CCTCGTTTTCAACCTGAAGACGG - Exonic
954957083 3:54530695-54530717 CCTCATTTTATAAATGAAGAAGG + Intronic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
957159842 3:76596540-76596562 CCTCATTTGTTAAATGTAGGTGG + Intronic
957231624 3:77524830-77524852 CCTAATCTGTATACTGTAGATGG + Intronic
957935211 3:86933653-86933675 CCTCATTAGTAAAAAGGAGATGG - Intergenic
958094110 3:88919332-88919354 CCTGATTTTGAAAGTGAAGAAGG + Intergenic
958150975 3:89694793-89694815 CCTCATTTAAAAAGTGAAGGAGG - Intergenic
958658667 3:97037012-97037034 CCTCATTAGTATACTTAAAAAGG - Intronic
959461745 3:106635101-106635123 CTTCATTGGTAAAATGGAGAGGG + Intergenic
960100450 3:113736988-113737010 CATCATCTGTAAAATGAAGGGGG - Intronic
960132482 3:114072099-114072121 CCTCATGTGGAAACAAAAGAGGG - Intronic
961151084 3:124638526-124638548 CAGCATTTGTAGAATGAAGAGGG - Intronic
962593892 3:136919720-136919742 TATAATTTGTAAACTGAGGAAGG + Intronic
962617692 3:137143646-137143668 CCTCATGGGCAAAGTGAAGATGG + Intergenic
963143050 3:141963736-141963758 TATCATTTGCAAACTCAAGAAGG - Intronic
963233031 3:142928005-142928027 CCTTATCTGTAAACTGGGGATGG + Intergenic
963383059 3:144556369-144556391 CCTCATATGTAACCTTAAAATGG - Intergenic
963643768 3:147888805-147888827 CCTCACCTGTTAAATGAAGATGG - Intergenic
964775778 3:160275062-160275084 CCTCATTTGTAAAATGGGGCTGG + Intronic
965004182 3:162996942-162996964 CCTGATTGGTAATCTGATGAAGG + Intergenic
965604836 3:170487502-170487524 CATCATTTATAAACTGAATGTGG - Intronic
965910629 3:173770729-173770751 CCTCATCTGTGAAATGAAAATGG + Intronic
966500126 3:180630039-180630061 CCTCACTTGGAAAATGAAGAGGG - Intronic
967360860 3:188629951-188629973 CAACATTTGTCAACTCAAGATGG + Intronic
967447712 3:189586012-189586034 CCTCATTTGTAAAATAATAATGG - Intergenic
968790528 4:2658197-2658219 CTTCATATGTAAACTGCAGATGG - Intronic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
969201626 4:5610992-5611014 CCTCATGTGTCAACTGGATAAGG + Intronic
969475824 4:7421988-7422010 CCTCATCTGTGAACTGAAGTGGG + Intronic
969895494 4:10300491-10300513 CCTCCTTTGTTAATTGCAGAGGG + Intergenic
970026579 4:11630378-11630400 GCTCATGTGTAAAATGAAGGAGG + Intergenic
970200345 4:13598531-13598553 CCTCGTTTGTAAAATGAGGGTGG + Intronic
970724791 4:19031051-19031073 CCTGTTTTGTAAAATGGAGATGG + Intergenic
971297595 4:25411662-25411684 TCTCATCTGTAAAATGAAGATGG + Intronic
971619721 4:28840742-28840764 GCTTATTTTGAAACTGAAGATGG + Intergenic
971901228 4:32660753-32660775 TCTCATTTGCAAACTGACAAGGG - Intergenic
972456634 4:39262082-39262104 CCCCATCAGTAAAGTGAAGAAGG - Intronic
973960213 4:56102393-56102415 CCTCATTTGTAAAATGAAGAAGG - Intergenic
974744374 4:66051755-66051777 CTTCATTTGAAAAATGATGATGG - Intergenic
976435134 4:85009283-85009305 TCTGCTTTGTGAACTGAAGAGGG + Intergenic
976521893 4:86037721-86037743 TCTCATTTGAAAATTGAATAAGG - Intronic
976781901 4:88769461-88769483 CCTCATCTGGAAAATGAAGATGG + Intronic
977455450 4:97254468-97254490 CCTCATCTGTAAGTTGAAGGTGG - Intronic
977688865 4:99880255-99880277 TCTCATATTTACACTGAAGAAGG + Exonic
978847423 4:113290763-113290785 CCTCATTTGAAAAATGGAAATGG - Intronic
978941223 4:114438131-114438153 CATCATTTGTAAACAGAATTTGG + Intergenic
979036053 4:115720012-115720034 CCTCATTAGTAGACTGGACATGG - Intergenic
979216713 4:118173382-118173404 CCTCATTTTTAAACAGAATTTGG + Intronic
979465250 4:121029940-121029962 TCTCATTTGTAAAATGAGAAGGG - Intergenic
979544741 4:121926892-121926914 CCTGATTTAGAAACTGAGGAAGG + Intronic
979551244 4:121993385-121993407 CCTCAAATGTAAATTGAAAAGGG + Intergenic
979973216 4:127163537-127163559 CCTCATTTGTAAATTGGGGAAGG - Intergenic
980254097 4:130353735-130353757 CCTCATCTGTAAAATGAAAGTGG + Intergenic
980794674 4:137665623-137665645 CCACATCAGTAAAATGAAGATGG + Intergenic
980834310 4:138172612-138172634 ACTCAATTAGAAACTGAAGATGG + Intronic
981595086 4:146411133-146411155 CCTCATTTTAAAGGTGAAGAAGG - Intronic
981785837 4:148478725-148478747 CCTCATTTGTAATTTGAAGATGG + Intergenic
981867211 4:149437396-149437418 CACCATTTATAAACTGATGATGG + Intergenic
981989150 4:150895022-150895044 CCTCATTTAAAAATTAAAGAAGG + Intronic
982289465 4:153765315-153765337 CTTCATCTGTAAACTGTGGATGG - Intergenic
983160260 4:164404688-164404710 TCTAATATGTAAAATGAAGATGG - Intergenic
983186195 4:164703768-164703790 CCTCATTAGTAATCAGAAAATGG + Intergenic
984039582 4:174714320-174714342 CCTGATTTTGAAATTGAAGAAGG - Intronic
985132454 4:186752302-186752324 TCTCATTTCTAAACAGAAGGAGG + Intergenic
987535328 5:19179981-19180003 ATTCATTAGTGAACTGAAGAAGG + Intergenic
988950364 5:36252165-36252187 CCTCATTCATAAAGGGAAGAGGG - Intronic
989496830 5:42118590-42118612 CCTCACTTGCAAAATAAAGAAGG - Intergenic
990121073 5:52452204-52452226 CCTCCTTGGTAAAATAAAGATGG + Intergenic
990200572 5:53368014-53368036 TCTCATTTGTAAAAAGAAAAAGG + Intergenic
990375423 5:55165811-55165833 CCTCACCTGTAAATTGAACAGGG + Intronic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
991086738 5:62654576-62654598 CCTCCTCTGTAAAATGGAGATGG + Intergenic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
992207786 5:74447776-74447798 CCTTATTTGGATACTGAAAAGGG - Intergenic
992277724 5:75137715-75137737 CTTCATTTGTAATTTGAAGCAGG + Intronic
992942691 5:81778146-81778168 CCTGATCCGTAAACTGAAGGTGG + Intergenic
993929459 5:93920310-93920332 CCTCATCTGAAAAGGGAAGATGG - Intronic
993969765 5:94404873-94404895 CCTCATTTATAAAATGGTGAGGG + Intronic
994087332 5:95773576-95773598 TCTCATTTGTGAAGTGAAGAGGG + Intronic
994294828 5:98078387-98078409 CCTTATTTGTAAAATGGAGATGG - Intergenic
995214535 5:109580554-109580576 CATCACTTGTACACTGTAGAAGG - Intergenic
995435571 5:112131286-112131308 CCTCCTTTGTAAAATGAGTATGG + Intergenic
997357850 5:133275724-133275746 GCTCATCTGTAAAATGGAGAGGG - Intronic
998607406 5:143649194-143649216 CCTCATTTATAAACTAGGGATGG - Intergenic
998630623 5:143894006-143894028 CATAATTTATAAAATGAAGATGG + Intergenic
998986293 5:147761379-147761401 CCTCATGTGTAAAATGGAAAAGG - Intronic
999168942 5:149576413-149576435 TCTCATTTGTAGAAAGAAGATGG + Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000062379 5:157668926-157668948 GCTCATTTGTAAAGTGAGAATGG + Intronic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000117527 5:158167273-158167295 CTTCATTTCTAAACTGAACATGG + Intergenic
1000632168 5:163602947-163602969 CCTCATTTGTAAAATAAAGATGG - Intergenic
1001127207 5:169030369-169030391 CCCCATCTGTAAATTGAAGAGGG - Intronic
1001287360 5:170433795-170433817 CCTCATTTGTAAAATAATAAGGG - Intronic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002077455 5:176717444-176717466 CCTCCTTTGTAAGCTGTGGAGGG - Intergenic
1002295484 5:178228584-178228606 CCCCACCTGTAAAATGAAGATGG + Intronic
1002827911 6:790479-790501 CCTCATCTGTAAAATGAAGGTGG - Intergenic
1003106409 6:3219817-3219839 CCTCATTTGTGAACTGATGAGGG + Intergenic
1003958657 6:11189683-11189705 CCTCATTTGCAAAATGAATGGGG - Intronic
1004003396 6:11616341-11616363 CCACATTTGTAAACTCCAGAAGG - Intergenic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1005773239 6:29098839-29098861 CATCATGTATAAACTGATGAAGG - Intergenic
1005945640 6:30593410-30593432 TCTCATCTGTAAAATGAAGGTGG + Intronic
1006969139 6:38022589-38022611 CCTCATTTGAAAAATGGAGTGGG - Intronic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007897133 6:45374392-45374414 CCTCATTTATAAAATGAAGATGG - Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1009507847 6:64507504-64507526 CATCTTTTGAAAGCTGAAGAGGG + Intronic
1009523598 6:64715487-64715509 CATCATTTGTGATCTCAAGAGGG + Intronic
1010438034 6:75858682-75858704 CCTTATTTGTCAACTGAAGCAGG + Intronic
1010535291 6:77020445-77020467 CCTCACTTGTAAGTTTAAGAGGG + Intergenic
1012318564 6:97813572-97813594 CCTTATTTGTAAAATTATGATGG - Intergenic
1012467564 6:99532494-99532516 TCTCATCTGTAAATTGAAAATGG + Intergenic
1012530301 6:100227564-100227586 CTTCATTTTCACACTGAAGAAGG + Intergenic
1012662501 6:101920144-101920166 CCATATTTATAAAATGAAGAGGG - Intronic
1012927230 6:105279748-105279770 CAAGATTTGAAAACTGAAGAAGG + Intronic
1013691427 6:112649264-112649286 CCTCATCTGGAAAATAAAGAAGG + Intergenic
1013812079 6:114056530-114056552 TCTATTTTGTAAACTGAATATGG - Exonic
1014467532 6:121774780-121774802 CCTCACTGGTAAACTGAAAGAGG - Intergenic
1015178208 6:130334440-130334462 CCTCATCTGTAAAATGAAAGAGG - Intronic
1016574547 6:145554148-145554170 ACTCAGCTGTAAACTCAAGAGGG - Intronic
1016723527 6:147331496-147331518 CCTCATTTATAAAATGAAGGTGG + Intronic
1017731798 6:157323587-157323609 CCTCCTGTGCAATCTGAAGAAGG + Exonic
1017891212 6:158640782-158640804 CCTCAGCTGTAAACTCCAGAAGG + Intronic
1019315491 7:382392-382414 ACTCAGTAGTAAAGTGAAGATGG + Intergenic
1019972428 7:4551795-4551817 CCTCTTCTGCAAATTGAAGATGG + Intergenic
1021229750 7:18071904-18071926 CCTCATTTGTAAAACCTAGATGG + Intergenic
1021725801 7:23547067-23547089 TATCATTTGTAACCAGAAGAGGG + Intergenic
1021761480 7:23906303-23906325 CATCAATTTCAAACTGAAGATGG + Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022040764 7:26579351-26579373 CCTCATCTGTAAAATGGAGCTGG + Intergenic
1022185361 7:27962005-27962027 CCTTATCTATAAAATGAAGATGG + Intronic
1022417771 7:30192550-30192572 CCTCATCTATAAAAAGAAGATGG + Intergenic
1022653074 7:32294504-32294526 TCTCATCTGTAAAATGAACAGGG + Intronic
1023312802 7:38904805-38904827 CCTAATTTCTAAAATGCAGAAGG + Intronic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024429491 7:49269838-49269860 CCACATTTGTCCAGTGAAGATGG - Intergenic
1026104764 7:67411977-67411999 CCTCATCTGTAAAAACAAGAAGG + Intergenic
1026577549 7:71585571-71585593 CCTCATTGGTCATCTTAAGAGGG - Intronic
1026899801 7:74030483-74030505 CCTGATTTCAGAACTGAAGATGG + Intronic
1028435944 7:90803783-90803805 CTTGATTAGTAAAATGAAGATGG - Intronic
1028435949 7:90803837-90803859 CTTGATTAGTAAAATGAAGATGG - Intronic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029642836 7:101832046-101832068 CCCGATTTTTAAACTGAAGAGGG + Intronic
1029734974 7:102460600-102460622 CCTCCTTTGTAAAATGGAGAAGG - Intronic
1029910092 7:104136615-104136637 CATCATTTGTAAATTTGAGAAGG + Intronic
1030046802 7:105504548-105504570 CCTCATTTGTAAAATGAAGATGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1031071277 7:117164872-117164894 GCTCATCTGTAAAGTGAGGAGGG + Intronic
1031263919 7:119559179-119559201 ACTCATAAGTTAACTGAAGAAGG - Intergenic
1032617683 7:133492829-133492851 TCTCAGTTGTAAAAGGAAGAAGG + Intronic
1032857327 7:135846287-135846309 TCTCATTTGTAAAATGAAGAGGG - Intergenic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1033448970 7:141446182-141446204 CCTCATTTTCACACTGAAGCTGG + Intronic
1033577211 7:142696969-142696991 CCTGAATTCTAAAGTGAAGAGGG + Intergenic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035905851 8:3509497-3509519 CCTCATCTTTAAAATGAAGAAGG + Intronic
1036764335 8:11537675-11537697 CCTCATTTTACCACTGAAGAAGG - Intronic
1037744412 8:21631398-21631420 CCTCATTTGTAAAATGGGAATGG + Intergenic
1037829818 8:22180797-22180819 CCTCATCTGTAAAATAAAGGTGG - Intronic
1038543088 8:28405041-28405063 CCTCATTTGTAAACCTGGGATGG + Intronic
1038693053 8:29780682-29780704 CCCCATCTGTAAAATGAAGGTGG + Intergenic
1039917912 8:41873355-41873377 CCTCACTTGCACACTGAAGATGG + Intronic
1041045771 8:53884553-53884575 CCTCATCTGTAAAACGAAGGAGG - Intronic
1041062208 8:54045127-54045149 CCTCTTCTGTAAAATCAAGATGG + Intergenic
1041222752 8:55668244-55668266 ACTCACTTGTACACTTAAGATGG + Intergenic
1041489212 8:58412766-58412788 CTTCATTTGTAAACTGAGGAAGG + Intronic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1041778317 8:61549228-61549250 CCTCATTAGGAGACTGAAGGGGG + Intronic
1042665716 8:71203447-71203469 GCTCAGTTGTAACCTGGAGAGGG + Intronic
1042892153 8:73624552-73624574 CCTCATCTGTAAAATGAAGTGGG - Intronic
1043663406 8:82776242-82776264 CTTCATTTGTGAAATGGAGATGG - Intergenic
1043964274 8:86454560-86454582 CTTCATTTTTAATCTGAAGATGG + Intronic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044522454 8:93215121-93215143 CATCATTTTGCAACTGAAGATGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045041620 8:98229987-98230009 CCTCACTTGTCAAATGTAGATGG - Intronic
1045110807 8:98938481-98938503 CCTGATTTGTCACCTTAAGATGG - Intronic
1045383025 8:101645608-101645630 CCTCATCTGTAAAAAGGAGATGG + Intronic
1045575297 8:103414493-103414515 CCTGATTTGTAAAATAAAGAAGG - Intronic
1045883621 8:107069924-107069946 CTTCATTTGTAACCTGAGAATGG - Intergenic
1046759480 8:118006637-118006659 CCTCAGTTGTTCACTGAAGTGGG - Intronic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047206678 8:122807934-122807956 CCTCATTTGTAAAATAAAAGGGG - Intronic
1047727640 8:127697891-127697913 CCTTATTTGGAAACCGAGGAGGG - Intergenic
1047797263 8:128270463-128270485 CCTCATTTGTAAAATGGAGATGG - Intergenic
1047810896 8:128408043-128408065 CCTCATGTGTAAGCTGGAGCTGG - Intergenic
1048078676 8:131101334-131101356 CCTCATTAGAAAACTCCAGAAGG - Intergenic
1048338843 8:133523466-133523488 CCTCCTCTGTAAAGTGAAGATGG + Intronic
1048456932 8:134586907-134586929 CCTCATTGGTAAAATGGGGATGG + Intronic
1048559785 8:135521624-135521646 CCTCATTTGTAATATGAGGTTGG + Intronic
1048643629 8:136392596-136392618 TCTCATCTGTTAAGTGAAGAAGG + Intergenic
1048809468 8:138272954-138272976 CCTCATCTGTGAACTGGGGATGG + Intronic
1049168573 8:141142787-141142809 CCTCTTCTGTAAAATGTAGATGG + Intronic
1049967257 9:790904-790926 CCTCTTTTTTAAAATGAGGATGG - Intergenic
1050728856 9:8684327-8684349 GCTCATTTGTAAAATAGAGATGG - Intronic
1050739392 9:8802748-8802770 CCTCATCTTTAAAATGGAGATGG + Intronic
1050871819 9:10581107-10581129 CCTCCTTTCTAAAATAAAGATGG + Intronic
1050953174 9:11623236-11623258 CTTCATTTCTAAAATGGAGAGGG + Intergenic
1051016613 9:12483744-12483766 GCTCATTAGTAAACTGCACATGG + Intergenic
1051432423 9:16993657-16993679 CATTATTTGAAAACTGAAGGGGG - Intergenic
1051577815 9:18637286-18637308 CCCCATTTGAGAACTGGAGAGGG + Intronic
1051686138 9:19659945-19659967 CCTCATTTTTAAGGTGAACAGGG + Intronic
1051922392 9:22283205-22283227 CCTCTTCTGTAAAATGAAGTTGG - Intergenic
1052641498 9:31172114-31172136 TCTCATTTGTAAATGAAAGAGGG - Intergenic
1052890699 9:33696855-33696877 CCTGAATTCTAAAGTGAAGAGGG + Intergenic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1053446905 9:38159594-38159616 CCTCATTTGTTAAATGGGGATGG - Intergenic
1055071432 9:72170564-72170586 CCTCATTCGTAAAATGGATATGG + Intronic
1055159863 9:73113236-73113258 CTTCATTTGTAAATTGTTGAAGG + Intergenic
1055553347 9:77451234-77451256 CCTCATTGGTAAAATGAGGAGGG + Intronic
1055849201 9:80605111-80605133 CCTCTTTTGTAAATTGAAACCGG - Intergenic
1055859979 9:80737788-80737810 CCTCAGCTGAAAACTAAAGAAGG - Intergenic
1057615515 9:96586409-96586431 CGTCTTTTGCAGACTGAAGAAGG - Intronic
1058477037 9:105346345-105346367 CCTCCTTTTTTAAATGAAGAAGG + Intronic
1058674535 9:107389184-107389206 CCTCAACTGTAAAATGGAGATGG + Intergenic
1058748685 9:108017483-108017505 TCTCACTTATAAAATGAAGATGG - Intergenic
1058956068 9:109949951-109949973 GCTTATGTGTAGACTGAAGATGG - Intronic
1059543977 9:115157994-115158016 CCTCATCTGTAAAAAGGAGATGG + Intronic
1060105346 9:120869644-120869666 CCTCAACTGTAAAGTGGAGATGG - Intronic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1060926939 9:127461665-127461687 CCTCGTGTGTAAACTGGGGATGG - Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061165372 9:128919297-128919319 TCTCATTTGTAAAATCAGGAAGG + Intergenic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1062239636 9:135529191-135529213 CCGCATCTGTAAAGTGCAGAAGG - Intergenic
1062302627 9:135883772-135883794 TCTCATTTGTAATGTGCAGATGG - Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1187003246 X:15204266-15204288 TCTCATTTAGAAACTCAAGAGGG - Intergenic
1188767984 X:34120763-34120785 CCTCATCTCTAAAATGAAAATGG + Intergenic
1188878834 X:35467032-35467054 CCTCATCTGTTAAATGAAGTTGG + Intergenic
1190309570 X:49107270-49107292 CCTCATATGTAAAATGGACATGG + Intergenic
1190489405 X:50966347-50966369 CCTCATTTGTAAAATGGAGATGG + Intergenic
1190886283 X:54533077-54533099 CCTCATCTGTAAATTGAGAATGG - Intronic
1190983135 X:55475646-55475668 CCTCATCTGTAAGATGAGGATGG + Intergenic
1190985564 X:55497537-55497559 CCTCATCTGTAAGATGAGGATGG - Intergenic
1191211860 X:57892732-57892754 CCTCAAATGTGAACTGAGGATGG - Intergenic
1192152109 X:68718862-68718884 CCTCATCTGTAAAGTGAGGGAGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192158832 X:68767774-68767796 CCTCAGTTGTCAACTGGAGCTGG - Intergenic
1193099755 X:77595711-77595733 CCTAAATGGTAAATTGAAGAAGG - Intronic
1193649880 X:84117997-84118019 CCTTAGTTGTACACAGAAGAAGG + Intronic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1193968660 X:88022190-88022212 CTTCATCTGTAGACTGAACATGG + Intergenic
1194239045 X:91421622-91421644 GCTCATTAGTAAATTGAACATGG + Intergenic
1194313542 X:92343810-92343832 CATTATATGTAAACTGAAGTGGG + Intronic
1194697222 X:97068243-97068265 CCTCATTTGTAAAATGACAGTGG + Intronic
1195325271 X:103753229-103753251 CCTCAACTATAAACTGAAGGAGG + Intergenic
1195755709 X:108196868-108196890 CCTCATCTGTAAAATCAACAAGG - Intronic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1197928513 X:131671893-131671915 CCTCTTGTGTAAACAGAATAGGG - Intergenic
1198103068 X:133438590-133438612 CTTCATCTGTAAACTGAAGGTGG - Intergenic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198472608 X:136962486-136962508 CTTCATTTATAAACTAAAAATGG + Intergenic
1200336094 X:155353110-155353132 TTTCATTTGTAAAATGGAGATGG - Intergenic
1200350376 X:155488117-155488139 TTTCATTTGTAAAATGGAGATGG + Intergenic
1200621812 Y:5457932-5457954 CATTATATGTAAACTGAAGTGGG + Intronic
1200879665 Y:8199622-8199644 ACTCATTTGGAAATTGAAGCTGG - Intergenic
1201055250 Y:9982502-9982524 ACTCAGTTGGAAACTGATGATGG + Intergenic
1201437965 Y:13979687-13979709 CATCTTTTGTAAACTCAGGATGG + Intergenic
1201700478 Y:16876112-16876134 CCTCTTTTGTTAATTGCAGAGGG - Intergenic