ID: 1129939802

View in Genome Browser
Species Human (GRCh38)
Location 15:79485568-79485590
Sequence GCTATGTGAACATCCCAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129939798_1129939802 30 Left 1129939798 15:79485515-79485537 CCTTTTTCTATTCTTTCTTTTCT No data
Right 1129939802 15:79485568-79485590 GCTATGTGAACATCCCAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129939802 Original CRISPR GCTATGTGAACATCCCAGTT AGG Intergenic
No off target data available for this crispr