ID: 1129945362

View in Genome Browser
Species Human (GRCh38)
Location 15:79534864-79534886
Sequence AGGGTGGGCCCCCATCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129945362_1129945371 -2 Left 1129945362 15:79534864-79534886 CCCCCAGGATGGGGGCCCACCCT No data
Right 1129945371 15:79534885-79534907 CTACCTGAAGTGATCTAAGTGGG No data
1129945362_1129945373 15 Left 1129945362 15:79534864-79534886 CCCCCAGGATGGGGGCCCACCCT No data
Right 1129945373 15:79534902-79534924 AGTGGGAGCACCTCGCTGAATGG No data
1129945362_1129945370 -3 Left 1129945362 15:79534864-79534886 CCCCCAGGATGGGGGCCCACCCT No data
Right 1129945370 15:79534884-79534906 CCTACCTGAAGTGATCTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129945362 Original CRISPR AGGGTGGGCCCCCATCCTGG GGG (reversed) Intergenic
No off target data available for this crispr