ID: 1129945605

View in Genome Browser
Species Human (GRCh38)
Location 15:79536955-79536977
Sequence CAGGCTGCTCAGATGGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129945600_1129945605 21 Left 1129945600 15:79536911-79536933 CCTCTGCTCAGTCATGGAAACAG No data
Right 1129945605 15:79536955-79536977 CAGGCTGCTCAGATGGTCCTGGG No data
1129945599_1129945605 22 Left 1129945599 15:79536910-79536932 CCCTCTGCTCAGTCATGGAAACA No data
Right 1129945605 15:79536955-79536977 CAGGCTGCTCAGATGGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129945605 Original CRISPR CAGGCTGCTCAGATGGTCCT GGG Intergenic
No off target data available for this crispr