ID: 1129949393

View in Genome Browser
Species Human (GRCh38)
Location 15:79572609-79572631
Sequence GACCTATACTTGGCCTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129949384_1129949393 26 Left 1129949384 15:79572560-79572582 CCCCCATCACTGGCCCTGGACCT No data
Right 1129949393 15:79572609-79572631 GACCTATACTTGGCCTCCCATGG No data
1129949388_1129949393 13 Left 1129949388 15:79572573-79572595 CCCTGGACCTCCAATAACAAATT No data
Right 1129949393 15:79572609-79572631 GACCTATACTTGGCCTCCCATGG No data
1129949382_1129949393 30 Left 1129949382 15:79572556-79572578 CCTACCCCCATCACTGGCCCTGG No data
Right 1129949393 15:79572609-79572631 GACCTATACTTGGCCTCCCATGG No data
1129949390_1129949393 6 Left 1129949390 15:79572580-79572602 CCTCCAATAACAAATTAATAAGC No data
Right 1129949393 15:79572609-79572631 GACCTATACTTGGCCTCCCATGG No data
1129949389_1129949393 12 Left 1129949389 15:79572574-79572596 CCTGGACCTCCAATAACAAATTA No data
Right 1129949393 15:79572609-79572631 GACCTATACTTGGCCTCCCATGG No data
1129949385_1129949393 25 Left 1129949385 15:79572561-79572583 CCCCATCACTGGCCCTGGACCTC No data
Right 1129949393 15:79572609-79572631 GACCTATACTTGGCCTCCCATGG No data
1129949386_1129949393 24 Left 1129949386 15:79572562-79572584 CCCATCACTGGCCCTGGACCTCC No data
Right 1129949393 15:79572609-79572631 GACCTATACTTGGCCTCCCATGG No data
1129949391_1129949393 3 Left 1129949391 15:79572583-79572605 CCAATAACAAATTAATAAGCATA No data
Right 1129949393 15:79572609-79572631 GACCTATACTTGGCCTCCCATGG No data
1129949387_1129949393 23 Left 1129949387 15:79572563-79572585 CCATCACTGGCCCTGGACCTCCA No data
Right 1129949393 15:79572609-79572631 GACCTATACTTGGCCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129949393 Original CRISPR GACCTATACTTGGCCTCCCA TGG Intergenic
No off target data available for this crispr