ID: 1129951366

View in Genome Browser
Species Human (GRCh38)
Location 15:79594667-79594689
Sequence GGGTTTCAAACTCAACTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129951366_1129951370 9 Left 1129951366 15:79594667-79594689 CCAGAGAGTTGAGTTTGAAACCC No data
Right 1129951370 15:79594699-79594721 ACTTACTGGTTGCGTGATGTAGG No data
1129951366_1129951367 -5 Left 1129951366 15:79594667-79594689 CCAGAGAGTTGAGTTTGAAACCC No data
Right 1129951367 15:79594685-79594707 AACCCATTTCTGAAACTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129951366 Original CRISPR GGGTTTCAAACTCAACTCTC TGG (reversed) Intergenic
No off target data available for this crispr