ID: 1129953041

View in Genome Browser
Species Human (GRCh38)
Location 15:79608862-79608884
Sequence TGCCATAGGGTGATGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129953041_1129953048 27 Left 1129953041 15:79608862-79608884 CCCTCACTCATCACCCTATGGCA No data
Right 1129953048 15:79608912-79608934 GGAGAACCCAAAGACGCACAAGG No data
1129953041_1129953046 6 Left 1129953041 15:79608862-79608884 CCCTCACTCATCACCCTATGGCA No data
Right 1129953046 15:79608891-79608913 TGCAGAGAATGCAGCCACAGTGG No data
1129953041_1129953049 28 Left 1129953041 15:79608862-79608884 CCCTCACTCATCACCCTATGGCA No data
Right 1129953049 15:79608913-79608935 GAGAACCCAAAGACGCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129953041 Original CRISPR TGCCATAGGGTGATGAGTGA GGG (reversed) Intergenic
No off target data available for this crispr