ID: 1129958082

View in Genome Browser
Species Human (GRCh38)
Location 15:79657577-79657599
Sequence CTGTATATACAAACAGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129958081_1129958082 -5 Left 1129958081 15:79657559-79657581 CCTTTTAGAATTGAGAGACTGTA No data
Right 1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129958082 Original CRISPR CTGTATATACAAACAGACAA TGG Intergenic
No off target data available for this crispr