ID: 1129958117

View in Genome Browser
Species Human (GRCh38)
Location 15:79657848-79657870
Sequence GAGGACAAAAGGAAGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129958117_1129958121 15 Left 1129958117 15:79657848-79657870 CCTGCAGTCTTCCTTTTGTCCTC No data
Right 1129958121 15:79657886-79657908 TTTGAGTCTCTGCCAATTGCAGG No data
1129958117_1129958122 24 Left 1129958117 15:79657848-79657870 CCTGCAGTCTTCCTTTTGTCCTC No data
Right 1129958122 15:79657895-79657917 CTGCCAATTGCAGGTGACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129958117 Original CRISPR GAGGACAAAAGGAAGACTGC AGG (reversed) Intergenic
No off target data available for this crispr