ID: 1129960799

View in Genome Browser
Species Human (GRCh38)
Location 15:79682205-79682227
Sequence TGGAGAGGTCTGGTATAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129960793_1129960799 -1 Left 1129960793 15:79682183-79682205 CCTTAGAAATCACCCAGGAGTTT No data
Right 1129960799 15:79682205-79682227 TGGAGAGGTCTGGTATAGATAGG No data
1129960791_1129960799 6 Left 1129960791 15:79682176-79682198 CCTAACACCTTAGAAATCACCCA No data
Right 1129960799 15:79682205-79682227 TGGAGAGGTCTGGTATAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129960799 Original CRISPR TGGAGAGGTCTGGTATAGAT AGG Intergenic
No off target data available for this crispr