ID: 1129965250

View in Genome Browser
Species Human (GRCh38)
Location 15:79729226-79729248
Sequence CAGAACTAAAACTCAGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129965250_1129965252 -3 Left 1129965250 15:79729226-79729248 CCCATCTCTGAGTTTTAGTTCTG No data
Right 1129965252 15:79729246-79729268 CTGTTACCCAAACCCCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129965250 Original CRISPR CAGAACTAAAACTCAGAGAT GGG (reversed) Intergenic
No off target data available for this crispr