ID: 1129968538

View in Genome Browser
Species Human (GRCh38)
Location 15:79757813-79757835
Sequence CTGGGGGACCAGAGGCAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129968525_1129968538 15 Left 1129968525 15:79757775-79757797 CCCGGCCAGGGAAGACTCAGTTC No data
Right 1129968538 15:79757813-79757835 CTGGGGGACCAGAGGCAGCACGG No data
1129968531_1129968538 -7 Left 1129968531 15:79757797-79757819 CCTTCCTTGCTGTCCCCTGGGGG No data
Right 1129968538 15:79757813-79757835 CTGGGGGACCAGAGGCAGCACGG No data
1129968527_1129968538 10 Left 1129968527 15:79757780-79757802 CCAGGGAAGACTCAGTTCCTTCC No data
Right 1129968538 15:79757813-79757835 CTGGGGGACCAGAGGCAGCACGG No data
1129968526_1129968538 14 Left 1129968526 15:79757776-79757798 CCGGCCAGGGAAGACTCAGTTCC No data
Right 1129968538 15:79757813-79757835 CTGGGGGACCAGAGGCAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129968538 Original CRISPR CTGGGGGACCAGAGGCAGCA CGG Intergenic
No off target data available for this crispr