ID: 1129970622

View in Genome Browser
Species Human (GRCh38)
Location 15:79774916-79774938
Sequence CTCCCTTGGAGGCAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129970622_1129970634 21 Left 1129970622 15:79774916-79774938 CCCTGCCCCTGCCTCCAAGGGAG No data
Right 1129970634 15:79774960-79774982 AAAGACAGAATCCATCACCCAGG No data
1129970622_1129970631 -9 Left 1129970622 15:79774916-79774938 CCCTGCCCCTGCCTCCAAGGGAG No data
Right 1129970631 15:79774930-79774952 CCAAGGGAGAAACAAAGAAGGGG No data
1129970622_1129970633 -3 Left 1129970622 15:79774916-79774938 CCCTGCCCCTGCCTCCAAGGGAG No data
Right 1129970633 15:79774936-79774958 GAGAAACAAAGAAGGGGTGGAGG No data
1129970622_1129970635 22 Left 1129970622 15:79774916-79774938 CCCTGCCCCTGCCTCCAAGGGAG No data
Right 1129970635 15:79774961-79774983 AAGACAGAATCCATCACCCAGGG No data
1129970622_1129970629 -10 Left 1129970622 15:79774916-79774938 CCCTGCCCCTGCCTCCAAGGGAG No data
Right 1129970629 15:79774929-79774951 TCCAAGGGAGAAACAAAGAAGGG No data
1129970622_1129970632 -6 Left 1129970622 15:79774916-79774938 CCCTGCCCCTGCCTCCAAGGGAG No data
Right 1129970632 15:79774933-79774955 AGGGAGAAACAAAGAAGGGGTGG No data
1129970622_1129970636 30 Left 1129970622 15:79774916-79774938 CCCTGCCCCTGCCTCCAAGGGAG No data
Right 1129970636 15:79774969-79774991 ATCCATCACCCAGGGTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129970622 Original CRISPR CTCCCTTGGAGGCAGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr