ID: 1129971423

View in Genome Browser
Species Human (GRCh38)
Location 15:79780869-79780891
Sequence TCCCCAGGCACTGTGTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129971423_1129971435 22 Left 1129971423 15:79780869-79780891 CCCTGGGACACAGTGCCTGGGGA No data
Right 1129971435 15:79780914-79780936 CTATTTGGGAGTTTCAGTCTTGG No data
1129971423_1129971430 7 Left 1129971423 15:79780869-79780891 CCCTGGGACACAGTGCCTGGGGA No data
Right 1129971430 15:79780899-79780921 GGCCTGCCACCTTTGCTATTTGG No data
1129971423_1129971431 8 Left 1129971423 15:79780869-79780891 CCCTGGGACACAGTGCCTGGGGA No data
Right 1129971431 15:79780900-79780922 GCCTGCCACCTTTGCTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129971423 Original CRISPR TCCCCAGGCACTGTGTCCCA GGG (reversed) Intergenic
No off target data available for this crispr