ID: 1129974650

View in Genome Browser
Species Human (GRCh38)
Location 15:79812115-79812137
Sequence TGCCCTGGCCAGGATCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129974642_1129974650 12 Left 1129974642 15:79812080-79812102 CCCTGCCTGAGGGAAATGATGGA No data
Right 1129974650 15:79812115-79812137 TGCCCTGGCCAGGATCTGGTGGG No data
1129974644_1129974650 7 Left 1129974644 15:79812085-79812107 CCTGAGGGAAATGATGGAGTTAC No data
Right 1129974650 15:79812115-79812137 TGCCCTGGCCAGGATCTGGTGGG No data
1129974637_1129974650 24 Left 1129974637 15:79812068-79812090 CCTCAATGTTACCCCTGCCTGAG No data
Right 1129974650 15:79812115-79812137 TGCCCTGGCCAGGATCTGGTGGG No data
1129974643_1129974650 11 Left 1129974643 15:79812081-79812103 CCTGCCTGAGGGAAATGATGGAG No data
Right 1129974650 15:79812115-79812137 TGCCCTGGCCAGGATCTGGTGGG No data
1129974640_1129974650 13 Left 1129974640 15:79812079-79812101 CCCCTGCCTGAGGGAAATGATGG No data
Right 1129974650 15:79812115-79812137 TGCCCTGGCCAGGATCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129974650 Original CRISPR TGCCCTGGCCAGGATCTGGT GGG Intergenic
No off target data available for this crispr