ID: 1129976181

View in Genome Browser
Species Human (GRCh38)
Location 15:79823761-79823783
Sequence ATCCATCTGCTGTAACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129976178_1129976181 20 Left 1129976178 15:79823718-79823740 CCTGCAAATATTCAAAAGCAATT No data
Right 1129976181 15:79823761-79823783 ATCCATCTGCTGTAACAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129976181 Original CRISPR ATCCATCTGCTGTAACAAAC TGG Intergenic
No off target data available for this crispr