ID: 1129977112

View in Genome Browser
Species Human (GRCh38)
Location 15:79831558-79831580
Sequence CTGCTCCTCATTTGGAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129977112_1129977118 3 Left 1129977112 15:79831558-79831580 CCTGCACTCCAAATGAGGAGCAG No data
Right 1129977118 15:79831584-79831606 AAGGGCACTGAAAAGAACATGGG No data
1129977112_1129977119 18 Left 1129977112 15:79831558-79831580 CCTGCACTCCAAATGAGGAGCAG No data
Right 1129977119 15:79831599-79831621 AACATGGGCTTTCAGATCAGAGG No data
1129977112_1129977117 2 Left 1129977112 15:79831558-79831580 CCTGCACTCCAAATGAGGAGCAG No data
Right 1129977117 15:79831583-79831605 AAAGGGCACTGAAAAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129977112 Original CRISPR CTGCTCCTCATTTGGAGTGC AGG (reversed) Intergenic
No off target data available for this crispr