ID: 1129977938

View in Genome Browser
Species Human (GRCh38)
Location 15:79838164-79838186
Sequence TTCCCAAACCCCAGTGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129977938 Original CRISPR TTCCCAAACCCCAGTGGGTT AGG (reversed) Intronic
901071350 1:6520419-6520441 TTCCCACACCTCATAGGGTTGGG - Intergenic
901646339 1:10718703-10718725 TGCCCACTCCCCAGTGGGTCAGG - Intronic
901724840 1:11233023-11233045 GTCCCATTCCCCAGTGGATTCGG + Intronic
901837539 1:11934233-11934255 TTCCCAAAACCCAAGGGGTGAGG - Intronic
902365185 1:15968537-15968559 TCCCCCAACCCAAGTGAGTTTGG - Intronic
903098316 1:21002305-21002327 TTCTCAAATTCCAGTGGTTTTGG - Intronic
903340564 1:22651764-22651786 TTCCCAAAGCCGAGTGGCTCTGG - Intergenic
905907192 1:41626992-41627014 TTCCCAAACCTCAGTGAGTCTGG - Intronic
909848856 1:80434462-80434484 TCCCCAAACCCCAGGCGGTACGG - Intergenic
912199500 1:107440252-107440274 TTCCCAAACCCAAGTCCTTTTGG - Intronic
915322185 1:155062166-155062188 TTCCCCAGCACCAGTGCGTTGGG + Intronic
915931963 1:160066346-160066368 TTCCCAAACTCCAGAAGGGTGGG + Intronic
917680412 1:177360473-177360495 TCCTCAAACCACAGTGGGGTTGG + Intergenic
918515494 1:185358616-185358638 TGCACAAAGCCCAGAGGGTTTGG + Intergenic
918639843 1:186826600-186826622 CTCAAAAACCCCAGGGGGTTGGG - Intergenic
919491578 1:198212061-198212083 TTCCCAGACTCCAGTGGGATGGG + Intronic
920409821 1:205750223-205750245 CGCACAAACCCTAGTGGGTTTGG - Exonic
923788172 1:237088155-237088177 TTTCCAATCCCAAGTGGCTTGGG + Intronic
1072200102 10:93150488-93150510 TCCACAAACCACAATGGGTTGGG - Intergenic
1073058174 10:100715293-100715315 TTCCCCACCCCAAGTGGCTTAGG + Intergenic
1074313810 10:112344334-112344356 TCCCCCAACCCCACTGGCTTTGG - Intergenic
1074818114 10:117159192-117159214 TTCTCAAACCCCAAAAGGTTGGG - Intergenic
1075967364 10:126624483-126624505 TCCCCAAATCCCACTGGCTTAGG - Intronic
1078347625 11:10564784-10564806 TCCCCAAACCACATTGGTTTGGG - Intronic
1079292399 11:19200097-19200119 CCCCCAAAACCCACTGGGTTTGG + Intronic
1079576454 11:22009246-22009268 TTCCAATATCCCAGTGGGGTAGG - Intergenic
1079914080 11:26346642-26346664 TACCCAAAGCCCAGTGCTTTTGG + Intronic
1084941926 11:72617597-72617619 TCCCCAAACCCCAGGGGGAGGGG + Intronic
1085759654 11:79230969-79230991 TTCCCCAACCCCAGTGAGTCCGG - Intronic
1086544891 11:87956578-87956600 TTCCCAGACCCCAGTGGACAAGG - Intergenic
1087432037 11:98067055-98067077 TTCTCAAACACCTGTGAGTTGGG + Intergenic
1087486102 11:98761618-98761640 TTCTCAAACACCTGTGAGTTGGG - Intergenic
1092079746 12:5705928-5705950 TTCACAAAGCCCTGTGGCTTGGG + Intronic
1092490156 12:8937746-8937768 TTCCCAAACCACCCTGGGTTGGG - Intronic
1092992116 12:13912954-13912976 GTCCCATACCTCAGTGGGTTTGG + Intronic
1093974778 12:25409362-25409384 GTCCCATTCCCCAGTGGATTCGG - Intronic
1096544918 12:52331429-52331451 TTCCCAAAACCCAGTGTGGGAGG - Intergenic
1096772058 12:53941386-53941408 CCCCCAATCCACAGTGGGTTTGG - Intronic
1097499970 12:60389635-60389657 TCCTCAAACACCTGTGGGTTGGG + Intergenic
1098915948 12:76257016-76257038 TTATCAAACCCCAGTTGGTGGGG + Intergenic
1101445097 12:104731877-104731899 TTCCCAATGCCCAGTACGTTGGG - Intronic
1102336757 12:112087648-112087670 ATCCCATAGCCCAGTAGGTTTGG + Intronic
1102479678 12:113213205-113213227 TTCCCACACTCCAGTTGTTTTGG - Intronic
1103184598 12:118945574-118945596 TTCCCACACCCCAGGGGTTGTGG + Intergenic
1103842417 12:123875907-123875929 CTCCCAAAACCCAGTGAGGTGGG - Intronic
1104766903 12:131335995-131336017 TGCCCCAAGCCCAGTGGGTTGGG + Intergenic
1105343079 13:19546249-19546271 TTCCCAGCCCCTATTGGGTTAGG + Intergenic
1106521271 13:30499839-30499861 TAACCAAATCCCAGTGGCTTGGG - Intronic
1111915632 13:94357255-94357277 TTCCAAACCCTTAGTGGGTTTGG + Intronic
1112467181 13:99654430-99654452 ATCCCAAGCCCCAGTGCGGTAGG + Intronic
1118625361 14:67654061-67654083 TTCCCATTCCCCAGTGGCCTTGG + Intronic
1120840413 14:89080558-89080580 GTCCCACACCCCAATGAGTTAGG + Intergenic
1124412263 15:29446295-29446317 TTCCCAGACCACACTGGCTTAGG + Intronic
1125371313 15:38980718-38980740 TTCCCATATCCCAGAGGTTTTGG + Intergenic
1129279248 15:74470947-74470969 GTCCTCAACCCCAGGGGGTTGGG - Intergenic
1129977938 15:79838164-79838186 TTCCCAAACCCCAGTGGGTTAGG - Intronic
1131598654 15:93825127-93825149 ATCCCATTCCCCAGTGGATTCGG - Intergenic
1132242113 15:100265950-100265972 TTCCCACACTCCGGTGGGTGTGG - Intronic
1132605949 16:793804-793826 TCCCCTAACCCCAGAGGGTCAGG + Intronic
1139166331 16:64569040-64569062 TTCACCAGCCCTAGTGGGTTCGG - Intergenic
1141282910 16:82645050-82645072 TTCCCAAACCCCTGAGGTTAAGG + Intronic
1142957266 17:3530397-3530419 TTCACAACCCCCAGTGAGATGGG - Intronic
1144371080 17:14592258-14592280 TTCCCAGACCCCTGGGAGTTAGG - Intergenic
1144677465 17:17171177-17171199 CTCTCAACCCACAGTGGGTTGGG - Intronic
1144942031 17:18948533-18948555 TCCCCAAAGCTCAGTGGGCTCGG - Intergenic
1144945716 17:18968558-18968580 CCCCCACCCCCCAGTGGGTTTGG - Intronic
1147169168 17:38608149-38608171 CTGCCCAACCCCAGTGGCTTGGG + Intergenic
1148919215 17:51015209-51015231 TCCCTAAACCCCAGTGGCTTAGG - Intronic
1150302695 17:64059581-64059603 GTCAAAAACCCCAGGGGGTTGGG - Intronic
1151753261 17:76054383-76054405 TTCCTAAACCTCACTGGGCTGGG - Intronic
1152035385 17:77869151-77869173 TTCCCAAACCACTGGGAGTTTGG + Intergenic
1152090387 17:78243434-78243456 TTCCCATAGCACTGTGGGTTAGG - Intergenic
1152805854 17:82355971-82355993 CTCCAAAACCCAAGTGGGCTTGG - Intergenic
1152922739 17:83073898-83073920 CTCCCATACCCCACTGGGCTGGG - Intergenic
1153501912 18:5758264-5758286 TTCACAAACCCCTGTCAGTTTGG - Intergenic
1153680137 18:7492723-7492745 TACCAAAACCCCCGTGGTTTTGG + Intergenic
1154214455 18:12405983-12406005 TTACCACACACCAGTGGGGTGGG + Intergenic
1154469245 18:14682580-14682602 TGACAAAACCCCAGTAGGTTAGG + Intergenic
1156262554 18:35458890-35458912 TCACCAATCCACAGTGGGTTTGG - Intronic
1157787204 18:50494709-50494731 CTCTCAACCCCCAGTGGGGTAGG - Intergenic
1160011565 18:75110306-75110328 TTCCCAAAGCCAAATGGCTTGGG + Intergenic
1160225077 18:77006116-77006138 TTCCTAAACGCCAGTGTGCTGGG + Intronic
1163597963 19:18231487-18231509 TTCCCACAGCCCAGAGGGGTTGG - Intronic
1163607875 19:18285413-18285435 GTCCCATTCCCCAGTGGATTTGG - Intergenic
1166101237 19:40572543-40572565 TTCCCACTCCCCACTGGGTTAGG - Intronic
925631515 2:5898703-5898725 TTCACAGAGCCCAGTGAGTTAGG + Intergenic
927512855 2:23655186-23655208 CTCCCAAGCTCCAGTGGCTTTGG - Intronic
931665459 2:64607149-64607171 TTCCCAAAACCCTGTGGGTGTGG + Intergenic
932252157 2:70253927-70253949 GTCCCATTCCCCAGTGGATTCGG - Intergenic
932322337 2:70831494-70831516 TTGCCAAACCCCAGAGGGCGTGG + Intronic
932457949 2:71861496-71861518 TTCCCAATCCACAGTGCTTTAGG - Intergenic
935019551 2:99216514-99216536 TTCCCACATCCCAGTGAGTCTGG - Intronic
935274862 2:101467423-101467445 TTCTTAAACCCCTGTGGTTTAGG + Intronic
935317320 2:101848596-101848618 ATCCCCAACCCCAGTGGGCCTGG - Intronic
940460495 2:153958222-153958244 CTCCCAACTCTCAGTGGGTTGGG - Intronic
940653438 2:156460245-156460267 TCACCAGACCCCAGTGGGCTAGG - Intronic
940987373 2:160062653-160062675 TCCCCAAGCCGCAGTGGGTGGGG - Intergenic
942547639 2:177081129-177081151 TTTCCACACCCCAGTGGAGTGGG - Intergenic
942650625 2:178163661-178163683 TTCCCAAACCCCAGGGGCGAGGG + Intergenic
942997011 2:182275162-182275184 TCACCAGACCCCAGTGGCTTTGG + Intronic
944119560 2:196226329-196226351 TCCCCAAAGCCCAGTGATTTGGG + Intronic
945493463 2:210482226-210482248 TTCCCAGACCTCAGGAGGTTTGG + Intronic
946159628 2:217828267-217828289 TGCCCAAACCCCAGCTGGTCAGG + Intronic
947543635 2:230995458-230995480 CTCCCAAACCCCAATTGGTTGGG - Intergenic
947912167 2:233808631-233808653 CTCCCCATCCACAGTGGGTTTGG + Intronic
948405851 2:237718347-237718369 TTACCAAAGACCAGTGGTTTCGG - Intronic
1168898300 20:1338845-1338867 TTCCCAAACCTCAGAGGAATGGG + Intronic
1172002799 20:31793445-31793467 TTGCCAAACCCAAGTTGTTTGGG - Intronic
1173397344 20:42691696-42691718 TTCCCAAAGAGCAGTGAGTTAGG - Intronic
1173937945 20:46884009-46884031 TGCCAAAACCCCAGTTGGTTTGG - Intergenic
1173951849 20:46999677-46999699 CGCCCCAACCCCAGTGGTTTGGG + Intronic
1174184714 20:48698373-48698395 TTTCCAAACCCCAGTGTTCTGGG + Intronic
1177161280 21:17550806-17550828 TTCAGAAAACTCAGTGGGTTAGG + Intronic
1178510561 21:33201815-33201837 TTTCCACACCCCTCTGGGTTGGG + Intergenic
1178693423 21:34769934-34769956 TTCTCTAACCTCAGTGGGGTTGG - Intergenic
1181430553 22:22879101-22879123 GTCCCAGACCACAGTGGGTCTGG + Intronic
1184680464 22:46070244-46070266 TTCCCAAACCGCAGAGGGGCCGG - Intronic
951214653 3:20012513-20012535 GTCCCATTCCCCAGTGGATTTGG + Intergenic
952518875 3:34134275-34134297 TTGCCATACCCCAGAGGTTTTGG - Intergenic
955777525 3:62449575-62449597 TTCCAAAACTCTAGTGGGTTGGG - Intronic
958552666 3:95637002-95637024 TTCATAAACCCCAGTTTGTTTGG - Intergenic
959412853 3:106046850-106046872 TGCTAAAACCCCAGCGGGTTAGG - Intergenic
959748947 3:109810455-109810477 TTCCCAAACCTCAGTCAGTAAGG + Intergenic
960892906 3:122469637-122469659 TTCCCAGACCAAACTGGGTTGGG - Intronic
962314716 3:134352005-134352027 GTCCCATTCCCCAGTGGATTCGG - Intergenic
970377919 4:15477810-15477832 TTCCCTAACCCCAGTGGCCAAGG + Intronic
970710522 4:18856806-18856828 TTCTCCATCCCCAGTGGGTAGGG - Intergenic
973340065 4:48994728-48994750 CTCCAAAAACCCAGTGGGTGAGG - Exonic
974850982 4:67404843-67404865 TCCACAAACCCCAGAGGGTCAGG + Intergenic
975811340 4:78173294-78173316 TTCCTAAACCCAAGAGGCTTGGG - Intronic
980594960 4:134942419-134942441 TGCTAAAACCCCAGTAGGTTAGG - Intergenic
983018143 4:162640317-162640339 TTCCAAAGCCCCAGAGGGTGTGG - Intergenic
986600507 5:9467948-9467970 TTACAACACCCCAGTGGGCTAGG + Intronic
992228553 5:74641384-74641406 TCCCCACTCCCCAGTGGGTGCGG + Exonic
992897514 5:81258327-81258349 TCCCCAAACCACAGTGGAATGGG - Intronic
995000301 5:107119674-107119696 ATCCCACAACCCAGTGAGTTTGG + Intergenic
995940091 5:117571126-117571148 CTCCCAAATTCCAGTGGGGTTGG + Intergenic
997828334 5:137127526-137127548 TACCCCTACCCCAGTGGGTCTGG + Intronic
998072168 5:139206382-139206404 TTCCCAAACGCCAGAGCTTTGGG + Intronic
1000456924 5:161460913-161460935 TTCCCAAGAGCCAGTGGTTTGGG - Intronic
1002056365 5:176599906-176599928 TTCCCAAAGCTCAGTGGGGGAGG + Intronic
1007465835 6:42050429-42050451 TTTCCGAAGCCCAGTCGGTTGGG - Intergenic
1010212498 6:73373180-73373202 GTCCCATTCCCCAGTGGATTCGG - Intronic
1017558582 6:155602015-155602037 CTCCCAGACCACAGTGGGCTTGG + Intergenic
1017716475 6:157217169-157217191 TGCAAAACCCCCAGTGGGTTCGG - Intergenic
1018546074 6:164937348-164937370 ATAAAAAACCCCAGTGGGTTAGG - Intergenic
1019003501 6:168776908-168776930 TTCACAAACAACAGTGCGTTTGG + Intergenic
1021919340 7:25468369-25468391 TTCCAAAATCCAAGTGGGTAAGG + Intergenic
1023665803 7:42522211-42522233 TTCCCAAACCCCTCTGGCTTTGG + Intergenic
1024574534 7:50753260-50753282 TTCTGAAACCCCAGGGGATTGGG + Intronic
1025190246 7:56890856-56890878 CTCCCAAAGACCAGTGGGTTGGG - Intergenic
1025681693 7:63686064-63686086 CTCCCAAAGACCAGTGGGATGGG + Intergenic
1026649537 7:72203441-72203463 TTCCCAAACTCCGGCAGGTTTGG + Intronic
1029606520 7:101602526-101602548 TTCCCAAGCCCCAGAGGCTTTGG + Intergenic
1029936627 7:104431978-104432000 AGCCCAAAGCCCAGTGGGGTAGG - Intronic
1033355983 7:140600665-140600687 TTCCCAAAGCTCAATGGGGTGGG + Intronic
1036664335 8:10729248-10729270 TTCCCAAACCCCACCCGGTCCGG - Intronic
1037900540 8:22685679-22685701 TTACAAAACCCAGGTGGGTTGGG + Intergenic
1038436745 8:27541664-27541686 TTCCCAAACCCCAAAGGGAAAGG - Intronic
1038572476 8:28674826-28674848 TTCCCAACCCTCAGTGGTATTGG + Intronic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1040903928 8:52445509-52445531 ATCCCATTCCCCAGTGGATTGGG + Intronic
1040940468 8:52827354-52827376 TTCCCAGAGCCCAGTGAGTGGGG + Intergenic
1043217393 8:77609492-77609514 TTGCTAAACCACAGTGGCTTGGG - Intergenic
1043927666 8:86056205-86056227 TTGCCAAAGCCCAGGGAGTTTGG + Intronic
1044003152 8:86910197-86910219 TTCCCATCCTCCAGTAGGTTAGG - Intronic
1045269624 8:100650658-100650680 TTCACAAACACCTGTGGGCTAGG + Intronic
1048430034 8:134361696-134361718 ACCCCAAACCCCAGTCTGTTGGG + Intergenic
1058427645 9:104889247-104889269 TTCCCAGATCCCAGTGGCATTGG - Intronic
1060704764 9:125788392-125788414 ATCCCAAAACCCATTGGGATGGG + Intronic
1060784391 9:126438694-126438716 TTCCCAGAGCCCAGTGGGGTGGG + Intronic
1060970738 9:127736173-127736195 TTCCCTTACTCCAGTGGGTGGGG - Intergenic
1061827793 9:133272691-133272713 TTCCCAAACCCCCATGATTTAGG + Intronic
1061843320 9:133373045-133373067 ATACAAAACCCAAGTGGGTTAGG - Intronic
1062126233 9:134864471-134864493 TTTCCCAACCCCAGTGGGGATGG - Intergenic
1190828666 X:54041967-54041989 TTCCCAAAAGCCAGTGTGTGAGG + Intronic
1192733225 X:73822132-73822154 TTCCCAAACCCCAGTCTCATTGG - Intergenic
1193526909 X:82602616-82602638 TTGCCACACCCCAGAGGTTTTGG - Intergenic
1193909943 X:87291938-87291960 TTCCTGAACCCCAATGTGTTAGG + Intergenic
1194596442 X:95864858-95864880 TTCCCAAATCCCAGTGCGGATGG + Intergenic
1195555078 X:106212311-106212333 TTTCCTTAACCCAGTGGGTTAGG - Intergenic
1195860787 X:109380642-109380664 TTCCCCAACCCCAGGGAATTTGG - Intronic
1196832859 X:119789931-119789953 GTCCCATTCCCCAGTGGATTCGG - Exonic
1197903131 X:131394549-131394571 TTGCCTGACCACAGTGGGTTGGG + Intronic