ID: 1129978435

View in Genome Browser
Species Human (GRCh38)
Location 15:79844248-79844270
Sequence AGTGTCACACCTGCTTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129978435_1129978441 30 Left 1129978435 15:79844248-79844270 CCAAGGGAAGCAGGTGTGACACT 0: 1
1: 0
2: 4
3: 21
4: 165
Right 1129978441 15:79844301-79844323 GGCTGGACAAAAGGAGTGACAGG 0: 1
1: 0
2: 0
3: 21
4: 170
1129978435_1129978439 13 Left 1129978435 15:79844248-79844270 CCAAGGGAAGCAGGTGTGACACT 0: 1
1: 0
2: 4
3: 21
4: 165
Right 1129978439 15:79844284-79844306 GCTTAGAAATGCTAAAAGGCTGG 0: 1
1: 0
2: 1
3: 16
4: 191
1129978435_1129978440 21 Left 1129978435 15:79844248-79844270 CCAAGGGAAGCAGGTGTGACACT 0: 1
1: 0
2: 4
3: 21
4: 165
Right 1129978440 15:79844292-79844314 ATGCTAAAAGGCTGGACAAAAGG 0: 1
1: 0
2: 1
3: 14
4: 214
1129978435_1129978437 9 Left 1129978435 15:79844248-79844270 CCAAGGGAAGCAGGTGTGACACT 0: 1
1: 0
2: 4
3: 21
4: 165
Right 1129978437 15:79844280-79844302 TCCAGCTTAGAAATGCTAAAAGG 0: 1
1: 0
2: 0
3: 17
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129978435 Original CRISPR AGTGTCACACCTGCTTCCCT TGG (reversed) Intronic
900168310 1:1253812-1253834 GGGGTCACACCTGCTGGCCTGGG - Intergenic
900608801 1:3535791-3535813 AGAGTCAGACCTGGTTCCCCTGG - Intronic
901316688 1:8314742-8314764 GGTGTGGCTCCTGCTTCCCTGGG + Intergenic
902071622 1:13744266-13744288 AAGGTCACACCTACTTGCCTTGG - Intronic
902772133 1:18651572-18651594 GGTGTCACATCTGCTTAACTTGG + Intronic
902784124 1:18722044-18722066 AGGGTTAGACCTGCTTCCCAGGG + Intronic
904038879 1:27573017-27573039 AGTGGCACCGCTGCTTCCCTAGG - Intronic
904984378 1:34532951-34532973 AGTGTCCCACCCTCTTTCCTGGG + Intergenic
906541039 1:46586224-46586246 CTTGGCTCACCTGCTTCCCTTGG + Intronic
906701814 1:47865047-47865069 AGAGTCCCATCTGCCTCCCTGGG - Intronic
909884974 1:80930102-80930124 AGTGTCACAATTGCTTACTTGGG - Intergenic
913158109 1:116120051-116120073 ATTGTCACGCCTGCTGCCCATGG - Intronic
915463766 1:156083998-156084020 AGTGCCATCCCTTCTTCCCTTGG - Intronic
920247921 1:204602332-204602354 ACTGTCACACCTGGCTCCTTGGG + Intergenic
922072689 1:222211712-222211734 ATTTTCCCAGCTGCTTCCCTGGG + Intergenic
923091551 1:230744958-230744980 ATTGCCACACCTGTCTCCCTAGG + Intergenic
923424950 1:233859518-233859540 AGAGTCATACCTGGTGCCCTTGG + Intergenic
1066454278 10:35559770-35559792 AGTGGCAGACCTGCTGGCCTCGG - Intronic
1067681377 10:48443587-48443609 AATGTCACAGCTGCTTAGCTAGG + Intergenic
1070985398 10:80685717-80685739 AGTTTCACACCTGTATTCCTCGG - Intergenic
1075754329 10:124799113-124799135 AGTGTCACACTTTGCTCCCTGGG - Intergenic
1078845455 11:15115276-15115298 TGTGTGGCACCTGCTGCCCTGGG + Intronic
1079904810 11:26232190-26232212 ATTGTAACACCTGCATCCCTGGG - Intergenic
1080747157 11:35118575-35118597 AGTGTTGCAGCTTCTTCCCTGGG + Intergenic
1083292653 11:61698568-61698590 CGTACCCCACCTGCTTCCCTGGG + Intronic
1083694737 11:64435142-64435164 AGTCTCACACGTGCTCCCGTCGG - Intergenic
1083735043 11:64675396-64675418 AGTGTCTCTCCCACTTCCCTAGG - Intronic
1085319821 11:75567086-75567108 AGTGACAGTCCTGCCTCCCTGGG - Intronic
1087137921 11:94739418-94739440 AGCCCCACCCCTGCTTCCCTGGG + Intronic
1089681840 11:120122903-120122925 AGTGTCTCTCCTGCTGCCCAGGG - Intronic
1091055350 11:132413071-132413093 AGTGTTACACCTGCTCATCTGGG + Intergenic
1091119724 11:133046869-133046891 AGTGACACCCCTGCTGCCTTAGG + Intronic
1092341883 12:7683924-7683946 TATGTCAAACCTGCTTCCTTGGG - Intergenic
1092773263 12:11917802-11917824 AGAGTCACACCTGGTGGCCTGGG + Intergenic
1095049409 12:37543247-37543269 AGTGCCACACGTGGTTGCCTTGG + Intergenic
1095133805 12:38573090-38573112 AGTCACACATCTGTTTCCCTAGG - Intergenic
1095974609 12:47930718-47930740 TCTGTCACTCCTGTTTCCCTGGG + Intronic
1100335187 12:93622663-93622685 AGTGTGAGACCAGCTTTCCTAGG - Intergenic
1102158670 12:110751003-110751025 AGTGTGACATCAGATTCCCTGGG - Intergenic
1102733930 12:115140736-115140758 AGTGCCACCCCTGCATCACTGGG + Intergenic
1103339328 12:120212997-120213019 AGTGTCACACCTGTGTTTCTGGG - Intronic
1104856013 12:131902841-131902863 AGGGCCACAACTGCCTCCCTGGG - Intronic
1105456864 13:20549049-20549071 AGTGTAATACATGCTTCCCTAGG - Intergenic
1107140470 13:36993213-36993235 AAGGACACACCTGCTTCCCAGGG + Intronic
1107370386 13:39739752-39739774 ACTGTCACATCTGTTTACCTTGG + Intronic
1109183350 13:59241170-59241192 AGTATGACACTTGTTTCCCTGGG - Intergenic
1113387982 13:109868891-109868913 AGGGACACACCTGCCTCCCTGGG + Intergenic
1114659834 14:24337076-24337098 AATGTCTCACCTGATTCCCTCGG + Exonic
1115190588 14:30743727-30743749 AAAGTCACACCTGCTTCCTGGGG - Intergenic
1118162907 14:63309036-63309058 AGTGCCACAGCAGCTTCCCCTGG + Intergenic
1118737234 14:68710717-68710739 ACTGTCACAACTGCAGCCCTAGG - Intronic
1119749050 14:77064710-77064732 AGAGTCACAGCTGTTGCCCTGGG + Intergenic
1122271779 14:100571497-100571519 AGTGTCACAGCAGCTTTGCTGGG + Intronic
1124197431 15:27644731-27644753 AGTGGGAGCCCTGCTTCCCTGGG + Intergenic
1126252696 15:46587869-46587891 TGTGTCACACATGCTGCCCAGGG - Intergenic
1127302062 15:57664391-57664413 AATGTCACCTCTGATTCCCTAGG - Intronic
1127722302 15:61715196-61715218 AGAGCCACACCTGCTTATCTTGG + Intergenic
1129978435 15:79844248-79844270 AGTGTCACACCTGCTTCCCTTGG - Intronic
1130070216 15:80640711-80640733 AGAGTGACAGCTGCTGCCCTTGG + Intergenic
1131642483 15:94307427-94307449 AGGGACACTCCTGCTACCCTGGG - Intronic
1132660683 16:1060149-1060171 AGAGTCTCACCAGCTTGCCTAGG - Intergenic
1133202404 16:4212339-4212361 AGTGGCACAGCTGCTTCCTGGGG - Intronic
1136140944 16:28288315-28288337 GGTTTCACAGCTGCTGCCCTTGG + Intergenic
1136479835 16:30534425-30534447 AGAGCCCCACCTGCTTGCCTGGG - Intronic
1137404309 16:48177755-48177777 CGTGTCACAGCAGCATCCCTGGG + Intronic
1137593344 16:49707184-49707206 TGTGTCACCTCTGCTTCCCCAGG + Intronic
1142111486 16:88334132-88334154 AGCTTCACGCCTGCCTCCCTTGG - Intergenic
1144326461 17:14186544-14186566 TGTGCCACACATGCTTGCCTTGG + Intronic
1144475339 17:15583419-15583441 TGTGCCACACATGCTTGCCTTGG + Intronic
1146665986 17:34703764-34703786 TGTGGCACACCCCCTTCCCTTGG - Intergenic
1148813798 17:50312466-50312488 GATGTCACACCTCCTGCCCTGGG + Intergenic
1149516804 17:57287241-57287263 AGTTTCACACTTCCTTTCCTTGG - Intronic
1149531328 17:57397583-57397605 AGAGTCACACATTCTTCTCTCGG - Intronic
1150934711 17:69623012-69623034 AGGGTCACACTTGCTTCTCAGGG - Intergenic
1153301657 18:3597014-3597036 AGTGTCACAGGTGCCTCCCACGG - Intronic
1158778332 18:60614982-60615004 TGTGGCACACTGGCTTCCCTTGG - Intergenic
1161839005 19:6667372-6667394 ATCATCACACCTCCTTCCCTGGG + Intronic
1163202205 19:15777476-15777498 AGAGTCACCTCTGCTTCCCTGGG - Intergenic
1164001304 19:21101926-21101948 AGTTTCACAACTCCCTCCCTGGG + Intronic
1164597047 19:29537195-29537217 AATGACACACCTCCTTCCCTGGG + Intronic
1168642444 19:58039121-58039143 AGTGTGGCACCGGCTGCCCTGGG - Intronic
925057225 2:864675-864697 GTTGTCACACCTGCGTCCCTAGG - Intergenic
928012331 2:27621482-27621504 AGCATCACATCTGCTTTCCTAGG - Exonic
930359260 2:50357998-50358020 AGTCCCTCACCGGCTTCCCTTGG - Intronic
931816576 2:65909167-65909189 AATGTCACACCTGGTTTCCATGG - Intergenic
937216604 2:120317126-120317148 TGCTTCCCACCTGCTTCCCTTGG - Intergenic
937970716 2:127546736-127546758 AATGCCTCACCTGCTTTCCTGGG + Intronic
941573153 2:167196676-167196698 TGTGCCACATCTGCTTTCCTTGG + Intronic
941948940 2:171132837-171132859 AGTGTCTCACTTTGTTCCCTAGG - Intronic
945742447 2:213680136-213680158 AGGGTGACACCTGATTCCCATGG + Intronic
947118857 2:226797387-226797409 AGTGTCACTCCGGATTCCCTGGG - Exonic
947672062 2:231943922-231943944 AGTTTCTCACCTGCTCACCTGGG + Intergenic
1169192609 20:3667723-3667745 TCTGTCACTCCTGCTTCCCTTGG - Intergenic
1170776058 20:19375493-19375515 AGTGTCAGAGCTGCTGGCCTGGG + Intronic
1171102930 20:22403134-22403156 AGTGACACACCTCCTTGCCCTGG - Intergenic
1171462532 20:25307032-25307054 AATGTCACCCCTGCTCCCTTAGG - Intronic
1171936450 20:31278934-31278956 AGTCTCTCACCTGGTTTCCTTGG + Intergenic
1172625592 20:36344847-36344869 AGGGTCCCCCCTCCTTCCCTAGG + Intronic
1173985591 20:47259267-47259289 AGGGACACACGTGCTTCCTTGGG - Intronic
1175092070 20:56512873-56512895 AGTCTCTCATTTGCTTCCCTGGG - Intronic
1175649028 20:60700904-60700926 ACTGTTACACTTGCTTTCCTTGG - Intergenic
1178398351 21:32262274-32262296 ACTGTCACAACTGCTTCCCTAGG - Intergenic
1179144215 21:38752989-38753011 AGCGTCCCACCTGATTCCCCAGG + Intergenic
1182674694 22:32029727-32029749 AGTGCCACACATGCTCCTCTAGG + Intergenic
1184390597 22:44201122-44201144 TGCTTCCCACCTGCTTCCCTGGG + Intronic
1184639387 22:45861215-45861237 AGAGCCCCACCTGCTTCCATTGG + Intergenic
1185136401 22:49075739-49075761 GGTTTCACACCTGCCTCTCTGGG - Intergenic
950936708 3:16846594-16846616 AGGGCCACAGCTTCTTCCCTGGG + Intronic
951057560 3:18164986-18165008 TATGTCACATCTGCTTCCTTAGG + Intronic
952942784 3:38456022-38456044 AGTCTCACACCTCCCTCCTTAGG + Intronic
953298123 3:41742162-41742184 AGTGGGCCACCTGTTTCCCTGGG - Intronic
954221100 3:49154427-49154449 TCTGTCATCCCTGCTTCCCTGGG + Intergenic
956460100 3:69462997-69463019 ACACTCACACCTGCTTCCCTGGG + Intronic
961167342 3:124772633-124772655 AATGTCACTCCTGCTTTCCAGGG + Intronic
963753357 3:149206256-149206278 AGTGTCTAACATGCTTCCCACGG + Exonic
967034422 3:185637457-185637479 AGTCTTACCCCTGCATCCCTGGG - Intergenic
968630331 4:1647457-1647479 AGGCTCACACCAGCTTCCCCAGG - Intronic
968652402 4:1765461-1765483 ACTGCCACCCCTGCATCCCTGGG + Intergenic
968808334 4:2788868-2788890 GGCTTCCCACCTGCTTCCCTGGG - Intergenic
969323488 4:6427096-6427118 AGTGTCACACTTGCTCCCCTTGG - Intronic
969611988 4:8232583-8232605 GTTGTGTCACCTGCTTCCCTGGG + Intronic
971070544 4:23086438-23086460 AGTGTCTCACTTACTGCCCTGGG + Intergenic
974007725 4:56575398-56575420 ACTGTCATACCTGCTCCCCTAGG + Intronic
975757836 4:77588386-77588408 GGTGTCACACCTGAATCCCTGGG - Intronic
976902507 4:90196437-90196459 AGTGTCATACCCGCTTCCCAGGG + Intronic
980017019 4:127661520-127661542 TCTGTGACACCTGCTTCCCTAGG + Intronic
980200099 4:129645493-129645515 TGTGTGACACCTGGTTCCTTTGG + Intergenic
982711345 4:158761249-158761271 AGAGCCACCCCTGCTTCTCTGGG - Intergenic
984694713 4:182767950-182767972 ACTCTCACTCCGGCTTCCCTAGG + Intronic
985355654 4:189116504-189116526 AGAGTCAGAACGGCTTCCCTGGG - Intergenic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
987682830 5:21160109-21160131 AGTCTCACACCTGTTGCCCAGGG + Intergenic
990042264 5:51389317-51389339 ACTTTGAGACCTGCTTCCCTTGG + Intronic
994416264 5:99475833-99475855 AAGGTCACCCCTGCTTTCCTGGG - Intergenic
994463704 5:100099339-100099361 AAGGTCACCCCTGCTTTCCTGGG + Intergenic
995684004 5:114751048-114751070 AGGGACACCCCTGCTTCCCCAGG - Intergenic
999257412 5:150217233-150217255 CTTCCCACACCTGCTTCCCTGGG - Intronic
1000715432 5:164637885-164637907 AGTGTCATGCCTCCTTCCCTAGG - Intergenic
1000722762 5:164729072-164729094 AATGTCTCACCTGCTGTCCTTGG + Intergenic
1001752933 5:174145346-174145368 AGGGTGACACCTGCTTCATTAGG + Intronic
1002073625 5:176695424-176695446 ATGATCACACCTGCTGCCCTGGG + Intergenic
1004551609 6:16653480-16653502 AAAGCCACACCTGCTACCCTTGG - Intronic
1005562365 6:27053912-27053934 GAGGTCAAACCTGCTTCCCTGGG + Intergenic
1005811300 6:29518451-29518473 AGAGTCACATCTGGGTCCCTGGG - Intergenic
1005897295 6:30189182-30189204 AGTCTCTCAGCAGCTTCCCTGGG + Exonic
1006610230 6:35290206-35290228 TGTGTCCCACCTTCTTCACTGGG + Intronic
1010098045 6:72069951-72069973 AGTGTCATACATGTTTTCCTGGG - Intronic
1011434001 6:87317798-87317820 AGTGTGCCACATGCTTTCCTGGG - Intronic
1012376485 6:98567720-98567742 AGTGCCACACATTCTTCTCTGGG + Intergenic
1017410390 6:154161825-154161847 AGTTTCACACATGCTGTCCTGGG - Intronic
1017821116 6:158049646-158049668 CTTGCCACAGCTGCTTCCCTGGG - Intronic
1021886888 7:25148056-25148078 AGTGTCCCTTCTCCTTCCCTGGG + Intronic
1022469366 7:30672772-30672794 AGTTTCCAACTTGCTTCCCTTGG - Intronic
1022532135 7:31073740-31073762 AGACTCACAGCTGCCTCCCTGGG - Intronic
1023511819 7:40961303-40961325 AGTGCCACACCTGCCTTCCTAGG + Intergenic
1024237289 7:47408167-47408189 AGTGTCCCACCTGCAGCCCTTGG - Intronic
1025867986 7:65404221-65404243 AGTGTCACACCTGCATCCATGGG + Intergenic
1026432972 7:70366666-70366688 AATGTCACTACTGCTGCCCTAGG - Intronic
1026678540 7:72448244-72448266 TGTGTCACAACTACTTCTCTTGG - Intergenic
1027623018 7:80515738-80515760 AGAGTCACAACTGTTTCCCAGGG + Intronic
1030225362 7:107144484-107144506 AGTGTCTCACTTTCTTGCCTAGG + Intronic
1030501330 7:110363734-110363756 AGTGTCACAGCTACTCCCCTGGG + Intergenic
1034473967 7:151272092-151272114 AATGTCACAACTGCTTCCTAGGG - Intronic
1035757460 8:2044839-2044861 AGTGTCACACCCGGTTTCCTGGG + Intergenic
1037847104 8:22293281-22293303 AGGGTCTCACTTGCTTGCCTAGG - Intronic
1038355207 8:26822938-26822960 AGTTTGACACCATCTTCCCTTGG - Intronic
1039536803 8:38323624-38323646 AGTGTCTCACCTTGTTCCCCAGG - Intronic
1042274649 8:66991653-66991675 AGAGTCACACCTCTTTCCCCAGG + Intronic
1047211388 8:122842983-122843005 AGTGTCACGCCTGCATCACCTGG - Intronic
1048273314 8:133046507-133046529 AGTGTTTCACTTGCTACCCTCGG - Intronic
1049274362 8:141712257-141712279 AACGTCACACCTGATTCCCAGGG - Intergenic
1052037311 9:23697008-23697030 TGTGTATCACCTGCCTCCCTGGG + Intronic
1053022776 9:34707524-34707546 AATTTCACACCTGCTGCCCTAGG + Intergenic
1054877355 9:70110784-70110806 AATGTCACAGCTGCTTCCTAGGG - Intronic
1055930853 9:81558680-81558702 GGTGTCACACCTGTAACCCTGGG + Intergenic
1056567480 9:87787056-87787078 AGAGACACAGCTGCTTGCCTTGG + Intergenic
1056760492 9:89411263-89411285 TGGGTCACTCTTGCTTCCCTGGG - Intronic
1056792278 9:89633566-89633588 AGGGTCACACCTGATTCCCTGGG + Intergenic
1059886427 9:118749505-118749527 ACTGTGACACCTGCATCCTTGGG - Intergenic
1062271703 9:135712861-135712883 AGTGTCAAAGCAGCTTCCCAAGG + Intronic
1062506839 9:136881928-136881950 AGAGTGAAACCAGCTTCCCTCGG + Intronic
1187764655 X:22627753-22627775 AGTGTAGCATCTGCTTGCCTGGG - Intergenic
1189099510 X:38174248-38174270 AATGTCGCACCTGGTTCCCAGGG + Exonic
1189846937 X:45146898-45146920 AGTCCCACACCTACTCCCCTGGG + Intergenic
1191936158 X:66429271-66429293 ACTGACACACCTGTTTCCTTGGG + Intergenic
1194715280 X:97280634-97280656 AGTGCCTCACCAGCTTCTCTAGG - Intronic
1196100357 X:111841331-111841353 AGTCTTACACCTGTATCCCTAGG + Intronic
1196648241 X:118141099-118141121 AGTGGCACACCTGCTGCCAAGGG + Intergenic
1196683608 X:118493231-118493253 AGTGTGACATATGCTTCCCATGG + Intergenic
1199816605 X:151403024-151403046 AGTGTGACAGTGGCTTCCCTGGG + Intronic