ID: 1129979042

View in Genome Browser
Species Human (GRCh38)
Location 15:79849446-79849468
Sequence CTGAGCTGTCACCTTTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129979042_1129979048 29 Left 1129979042 15:79849446-79849468 CCTCCTCAAAGGTGACAGCTCAG 0: 1
1: 0
2: 3
3: 13
4: 127
Right 1129979048 15:79849498-79849520 CAAGCTTCCCTCACACACACTGG 0: 1
1: 0
2: 0
3: 16
4: 189
1129979042_1129979047 1 Left 1129979042 15:79849446-79849468 CCTCCTCAAAGGTGACAGCTCAG 0: 1
1: 0
2: 3
3: 13
4: 127
Right 1129979047 15:79849470-79849492 GGGGCTTAAAAATCATGCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129979042 Original CRISPR CTGAGCTGTCACCTTTGAGG AGG (reversed) Intronic
900161596 1:1226723-1226745 CCAAGCTGTCTCGTTTGAGGAGG - Intronic
900866018 1:5269219-5269241 CTGCCCTGTCAGCTTTGAAGTGG + Intergenic
903181434 1:21606926-21606948 CTGGGGTGTCTCCTTTGAGGAGG - Intronic
903538496 1:24082877-24082899 CTGAGATGACACCGTGGAGGGGG + Intronic
904294084 1:29506562-29506584 CTGAGCTCTCAGCAATGAGGTGG + Intergenic
904529803 1:31160908-31160930 CTGAGCTGTTACCTTTCAAGAGG + Intergenic
907734867 1:57102855-57102877 CTGAGCTGACAGTTTTCAGGAGG - Intronic
908015640 1:59831315-59831337 CTAAGCTGTGACCTTTTTGGGGG + Intronic
909488184 1:76197518-76197540 CTGAGCTGAAAACTTAGAGGAGG + Intronic
910278797 1:85475801-85475823 CTGAACTCTTACCTCTGAGGTGG + Intronic
910935298 1:92481826-92481848 CAGAGCTGTCTCCTTGCAGGTGG - Intronic
911008535 1:93253593-93253615 CTGAGCTGGGACCTTTGCTGAGG + Intronic
911264809 1:95730751-95730773 TGGAGCTCACACCTTTGAGGAGG + Intergenic
916485027 1:165250989-165251011 CTCACCTGTCACCTTTCTGGAGG - Intronic
916488618 1:165281307-165281329 CTCAGCTGACACCTTTCAGTGGG - Intronic
920839877 1:209545347-209545369 CTGAGCTGTCACCTGGGGGCAGG - Intergenic
921262975 1:213400154-213400176 CTGAGCAGTCAGTTCTGAGGAGG - Intergenic
922061736 1:222099175-222099197 CTGGGGTGTCACGTTGGAGGTGG + Intergenic
1067998923 10:51308874-51308896 AGGAGCTGAGACCTTTGAGGAGG + Intronic
1069579377 10:69554876-69554898 CTGAGCAGGAACCCTTGAGGGGG + Intergenic
1069682819 10:70297427-70297449 CTGACCTCTGACCTTTGGGGTGG + Intergenic
1070480640 10:76879211-76879233 CTGAGCTGTCAATGTCGAGGAGG + Intronic
1074407456 10:113191552-113191574 CTGAACTGGCACCTTCTAGGAGG + Intergenic
1076859376 10:133133474-133133496 CTGTTCTGTAGCCTTTGAGGTGG + Intergenic
1081201924 11:40226989-40227011 TTGAGGTCTCACCTTTCAGGAGG - Intronic
1082106582 11:48227978-48228000 CTGCACTGACACCTTTGTGGAGG + Intergenic
1083252994 11:61480503-61480525 CTGATCTGTCACCTTTGATGAGG - Intronic
1083722578 11:64610763-64610785 CTCAGCTGTCAGCTCTCAGGAGG + Intronic
1086069928 11:82789062-82789084 CTGACCTCTGACCTCTGAGGGGG - Intergenic
1086220647 11:84438535-84438557 CTGAAATATCACCTTTGGGGAGG + Intronic
1087190350 11:95247904-95247926 CTCAGGTGTCACCTTTGCTGTGG - Intergenic
1088758584 11:112907896-112907918 TTGACCTGTAATCTTTGAGGAGG - Intergenic
1089117624 11:116108935-116108957 CTGAGCTGTCATCTCTGTGAAGG + Intergenic
1089663225 11:119999314-119999336 AGGAGGTGTGACCTTTGAGGAGG + Intergenic
1092523219 12:9294066-9294088 CTGTGCTGTCTCTTTTGAGCTGG + Intergenic
1092544073 12:9437833-9437855 CTGTGCTGTCTCTTTTGAGCTGG - Intergenic
1093545348 12:20338588-20338610 CTCAGCAGACCCCTTTGAGGAGG - Intergenic
1094605819 12:31948248-31948270 CTCAGCTTTCACCTCAGAGGAGG + Intergenic
1095254684 12:40020661-40020683 CTGTGCCTTCCCCTTTGAGGTGG + Intronic
1097405584 12:59185483-59185505 CTCAGATGTCACCACTGAGGAGG + Intergenic
1098595530 12:72270717-72270739 CCTAGATGTCACCTTTGGGGTGG + Intronic
1100813625 12:98364297-98364319 CTGAGCTCTCAGCTTTGCTGAGG - Intergenic
1111699017 13:91662310-91662332 CTGACATGTCACCTATGATGAGG + Intronic
1112383639 13:98917835-98917857 ATGATCTGGCACCTTTGAGCCGG + Intronic
1113260106 13:108552306-108552328 CAGAGCTGTCAACTTGGAGGTGG + Intergenic
1117749223 14:58903041-58903063 CTGAGCTGTACCCTCTGAAGTGG - Intergenic
1120759238 14:88271133-88271155 ATGAGCAGTCAGCTTGGAGGTGG - Intronic
1129979042 15:79849446-79849468 CTGAGCTGTCACCTTTGAGGAGG - Intronic
1131158615 15:90090259-90090281 CTCAGAGGTCACCTTTGATGAGG - Intronic
1136040302 16:27573455-27573477 CTGCACTGTCACCTATGTGGTGG + Intronic
1136429396 16:30187932-30187954 TTGAGCTGTCACCCTGTAGGTGG - Exonic
1140486450 16:75297440-75297462 CTCAGTGGCCACCTTTGAGGAGG - Intronic
1141525142 16:84606303-84606325 CTGGGCTGTTACTTTGGAGGAGG + Intronic
1143360956 17:6370759-6370781 TTGAGGTGTCAGCTTGGAGGTGG - Intergenic
1144095403 17:11895900-11895922 CTGAGATGACTCCTTTGAAGGGG - Intronic
1148833475 17:50452087-50452109 CTCTGCTGGCACCTTTAAGGTGG + Intronic
1151386648 17:73759187-73759209 ATGGGCTGTCACCCCTGAGGAGG + Intergenic
1156208505 18:34912386-34912408 CTGAGATAACTCCTTTGAGGTGG + Intergenic
1156244140 18:35281872-35281894 CTGAGCTGTCAACTTGGAATGGG + Intronic
1156842172 18:41622163-41622185 CTGACATGTCACCTGTGAGAGGG - Intergenic
1156997445 18:43484968-43484990 CTGCCCTGCCACCTTGGAGGTGG + Intergenic
1160173381 18:76572836-76572858 CTGAGCTGTAACCATGAAGGTGG + Intergenic
1161013090 19:1969510-1969532 GTGAGCCGTGAGCTTTGAGGCGG + Exonic
1163786304 19:19276759-19276781 CTGAGCCCGCACCCTTGAGGTGG + Intronic
1165166472 19:33860646-33860668 CTGGGCTGTGACCTTCAAGGAGG - Intergenic
1166269550 19:41705593-41705615 CTGATGTGTCACCTGGGAGGAGG - Intronic
1167202038 19:48072562-48072584 CTGAGCTATCACCTTGGAAAAGG + Intronic
925196229 2:1928367-1928389 CTGTACTGTCACCTTTCAGAGGG - Intronic
931900376 2:66781722-66781744 CTGAGCTGGTAGCTTTTAGGGGG + Intergenic
937662517 2:124446742-124446764 CTTTGCTGTCACCTGTGAAGAGG - Exonic
941385684 2:164848326-164848348 CAGAGCTCTCAGCTTGGAGGAGG - Intergenic
948062480 2:235051999-235052021 CTGTCCTGTCACCATTCAGGAGG + Intronic
948927241 2:241107190-241107212 CTGACCTGTCACCTGTGAGAGGG - Intronic
1169186167 20:3619030-3619052 CTGAGCTCTCACCCTTGGTGGGG + Intronic
1171239211 20:23551525-23551547 CTGAGCTCTGACCTTGGATGTGG + Intergenic
1172055113 20:32149552-32149574 GTCAGCTGTCACCTTGGGGGTGG + Intronic
1172409602 20:34711401-34711423 CTGAGCTGTCAGCCTTGGGATGG - Exonic
1173152649 20:40581057-40581079 CTGAGGGGTCACATTTGAGGGGG - Intergenic
1175408922 20:58753271-58753293 GTGCGCTATCACCATTGAGGAGG + Intergenic
1176936093 21:14868721-14868743 CTGATCTGTCTCCTTTGACAAGG + Intergenic
1177022807 21:15884249-15884271 CTGAACTGGCAGCTCTGAGGTGG - Intergenic
1181858435 22:25799605-25799627 CTGGGCTGTTACCTTGGCGGGGG + Intronic
1181910113 22:26231852-26231874 CTTAGCTGTCACCTGAGTGGAGG + Intronic
1183937889 22:41274306-41274328 CAGAGCTGTCACATGTGAGGTGG - Intronic
1185006412 22:48279266-48279288 CTGGGCTGGCAGCTGTGAGGTGG - Intergenic
1185416833 22:50715208-50715230 CTGAGCTGTGGCCATTTAGGGGG - Intergenic
949296244 3:2527328-2527350 CTGTTCTGTCACCTTAGAAGTGG + Intronic
949296863 3:2534738-2534760 CTGTTCTGTCACCTTAGAAGTGG + Intronic
949651249 3:6162403-6162425 CTTAGTTGTCAGTTTTGAGGAGG + Intergenic
953060196 3:39421513-39421535 CCTAGCTGTCACCATTGATGGGG - Intergenic
955229832 3:57088961-57088983 CAGAGCTGTTTTCTTTGAGGGGG + Intergenic
961736520 3:129005173-129005195 CTGAGCAGCCACCTGTGAGCAGG + Intronic
967386577 3:188917554-188917576 CTGACCTGTCACCTCTAAGCTGG - Intergenic
972333004 4:38080801-38080823 CTCAGCTGTCTCCTTAGGGGTGG + Intronic
975915246 4:79317365-79317387 CTGAGTTTTCATCCTTGAGGAGG - Exonic
977798456 4:101196709-101196731 CTGATCTTTCACTTTTAAGGAGG - Intronic
984947495 4:184981395-184981417 CTGAGCTCTGGCCTTTGGGGTGG - Intergenic
986673989 5:10167830-10167852 GTTACCTGGCACCTTTGAGGTGG - Intergenic
986701734 5:10416945-10416967 CTGATCTGTGAACTTTGAGGTGG - Intronic
987068899 5:14317416-14317438 ATGAGGTGTCACCTCTGGGGAGG + Intronic
987664846 5:20923771-20923793 ATGATCTCTCACCTTTGAGGTGG + Intergenic
988757840 5:34278395-34278417 ATTATCTCTCACCTTTGAGGTGG - Intergenic
992158953 5:73982027-73982049 CTGAGCTGTTGCTTTTGAGGAGG - Intergenic
994370803 5:98964870-98964892 CTGAAATGTCACCTTTCAGCAGG + Intergenic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
999387691 5:151166782-151166804 CTCAGGTGTCAACCTTGAGGTGG - Intergenic
1001228506 5:169965871-169965893 CTGGGCTCTCACCTTTGACGTGG + Intronic
1002640793 5:180629713-180629735 CTCAGGTGTCACCTTTGACTGGG - Exonic
1003377720 6:5594785-5594807 CTGTGCTGGCATCTCTGAGGAGG + Intronic
1003477985 6:6502519-6502541 CTGGGCTGTCACTTAGGAGGGGG - Intergenic
1004464566 6:15872634-15872656 CTCATCTGTCACCTCTGAGATGG + Intergenic
1006224282 6:32522814-32522836 CTGAACTGTCACCCTTCAGAAGG - Intronic
1007374093 6:41444509-41444531 CTGGCATGTCACCTCTGAGGGGG - Intergenic
1007552511 6:42741008-42741030 GTTAGCTGTAATCTTTGAGGAGG - Intergenic
1008317075 6:50057468-50057490 TTTAGCTGTATCCTTTGAGGAGG - Intergenic
1015223153 6:130827532-130827554 CTGTGCTGTCAGCTTTCATGAGG + Exonic
1015897993 6:138035296-138035318 CTGAGGTGTCAGCTATCAGGAGG - Intergenic
1019696837 7:2450941-2450963 CTGAGCTGCCACCCCTGCGGGGG - Intergenic
1021848899 7:24788717-24788739 CTAAGGTGTCAGCTTTGAGAAGG - Intergenic
1026057201 7:66995232-66995254 CTGAGCCGTCACCTCCGAGGCGG - Intronic
1026720912 7:72829819-72829841 CTGAGCCGTCACCTCCGAGGCGG + Intergenic
1033191565 7:139285403-139285425 CTGTGCTGTCACACTTGAGTAGG + Intronic
1033474863 7:141682231-141682253 CTGTGATGTCTCCTTTGGGGTGG + Intronic
1035039855 7:155919726-155919748 CTGGGGTATCACCTTAGAGGGGG + Intergenic
1035637678 8:1159069-1159091 CTGCTCTGTTACCCTTGAGGAGG + Intergenic
1036591928 8:10176307-10176329 CAGAGCTGGCATCTCTGAGGAGG - Intronic
1037387248 8:18356608-18356630 CTGGGCTGTGACCTTTGAAAGGG + Intergenic
1043033116 8:75164170-75164192 CTGAGCTATCACCTTTGAGATGG - Intergenic
1045633105 8:104150542-104150564 CTGAGATGACACCTCTGATGAGG - Intronic
1048044313 8:130758966-130758988 CTGAGCTGTCACATTAGAGGAGG - Intergenic
1051493676 9:17695539-17695561 CTCAGATGGCAACTTTGAGGAGG + Intronic
1056764999 9:89439651-89439673 CTGAGCTGACACCTTTTAGATGG - Intronic
1057216244 9:93230423-93230445 CTGAGCTGTGCCCTGGGAGGAGG - Intronic
1060047567 9:120352632-120352654 ATGAACATTCACCTTTGAGGGGG - Intergenic
1060190568 9:121589730-121589752 AGGAGCTGTCACCTCTGGGGAGG - Intronic
1060637588 9:125211585-125211607 CTGAGCTGCCACCTATCAAGAGG + Intronic
1062252277 9:135604389-135604411 CTTTGCTGTCACCGTTGAGCCGG + Intergenic
1186182552 X:6987051-6987073 CAGAGCAGTCACCTCTGATGTGG + Intergenic
1186568219 X:10686935-10686957 CTGAGCTGTGACCTTATGGGTGG + Intronic
1188137354 X:26505569-26505591 TTTAGCTGTCAACTTTGAGATGG - Intergenic
1188416459 X:29941149-29941171 TTGAGCTGTCACCTGTGGGTTGG - Intronic
1197389063 X:125838787-125838809 CTGACCTTTAATCTTTGAGGAGG - Intergenic
1198894671 X:141439815-141439837 CTGAGCTGTCTTATTTCAGGAGG - Intergenic
1199399717 X:147383708-147383730 CTGAGATGTCACCTTGGTGTTGG - Intergenic