ID: 1129980554

View in Genome Browser
Species Human (GRCh38)
Location 15:79865643-79865665
Sequence CTGAGGGTAAGCAGGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 334}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129980554_1129980564 24 Left 1129980554 15:79865643-79865665 CCCTCATCCCTGCTTACCCTCAG 0: 1
1: 0
2: 3
3: 35
4: 334
Right 1129980564 15:79865690-79865712 ATGGCCATGAATCCTAACAAAGG 0: 1
1: 0
2: 0
3: 7
4: 117
1129980554_1129980563 5 Left 1129980554 15:79865643-79865665 CCCTCATCCCTGCTTACCCTCAG 0: 1
1: 0
2: 3
3: 35
4: 334
Right 1129980563 15:79865671-79865693 TGCTAGGCAAAATGTGGGTATGG 0: 1
1: 0
2: 0
3: 7
4: 182
1129980554_1129980561 -1 Left 1129980554 15:79865643-79865665 CCCTCATCCCTGCTTACCCTCAG 0: 1
1: 0
2: 3
3: 35
4: 334
Right 1129980561 15:79865665-79865687 GCAGTGTGCTAGGCAAAATGTGG 0: 1
1: 0
2: 1
3: 21
4: 204
1129980554_1129980562 0 Left 1129980554 15:79865643-79865665 CCCTCATCCCTGCTTACCCTCAG 0: 1
1: 0
2: 3
3: 35
4: 334
Right 1129980562 15:79865666-79865688 CAGTGTGCTAGGCAAAATGTGGG 0: 1
1: 0
2: 1
3: 18
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129980554 Original CRISPR CTGAGGGTAAGCAGGGATGA GGG (reversed) Intronic
900078977 1:841477-841499 CTGACGATAAGCAGAGATGCTGG + Intergenic
900120498 1:1046730-1046752 CTGGGGGTGAGCAGGGATCAAGG + Exonic
900183802 1:1324000-1324022 CTGAGGGTCTGCTGGGCTGAGGG + Intronic
900183844 1:1324112-1324134 CTGAGGGTCTGCGGGGCTGAGGG + Intronic
900183885 1:1324208-1324230 CTGAGGGTCTGCGGGGCTGAGGG + Intronic
900954959 1:5881097-5881119 CTGAGGGTAGGCAGGAGTGAAGG - Intronic
900993567 1:6108715-6108737 ATGAAGGGAAGGAGGGATGATGG + Intronic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
902666989 1:17946505-17946527 GTAAGGGGGAGCAGGGATGAGGG + Intergenic
902773509 1:18660009-18660031 TTGAGGGGAAGCATGGATGTAGG + Intronic
903342250 1:22661800-22661822 CTGAGGATCAGAAGGGATGAAGG + Intergenic
905078671 1:35297368-35297390 CTGAGGGTGAGATGGGAGGATGG + Intronic
905365343 1:37448259-37448281 GGGAGGGAAGGCAGGGATGATGG - Intergenic
906672149 1:47664209-47664231 CTGAGAAGAAGCAGGGAGGATGG + Intergenic
907242710 1:53089731-53089753 TTCAGGGTCAGCAGGGATCAGGG - Intronic
907831340 1:58067038-58067060 CTGATGGGGAGCAGAGATGAGGG - Intronic
908570850 1:65408503-65408525 CACAGGGTAAGCAAGCATGAGGG + Intronic
909252984 1:73381789-73381811 CTGTGGGTTGCCAGGGATGAAGG + Intergenic
909564406 1:77038895-77038917 CTGGGGGTGGGCAGGGGTGATGG + Intronic
910439865 1:87240990-87241012 CTGAGGGCTGGCAGGGATGGAGG + Intergenic
911237894 1:95431435-95431457 CCTAGGGCAAACAGGGATGAGGG + Intergenic
911496323 1:98636210-98636232 CTGAGAGTAAGAAGGGAGGCTGG + Intergenic
912058626 1:105636332-105636354 CTGAGGGACAGCAAGGAGGAGGG - Intergenic
912199470 1:107440118-107440140 CTGAGAGTAAGCAGGCATTTAGG + Intronic
912823478 1:112885596-112885618 CTGAGGGTGAGCTGGGAAGAAGG - Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913301872 1:117379633-117379655 CTAGGGGGAAGCAGGGAGGAGGG - Intronic
915626795 1:157118801-157118823 CTGAGGGGAGGCAGGGTTGAAGG + Intergenic
915735305 1:158080864-158080886 CTGTGGGTAAGCAGGTACGCAGG - Intronic
916417932 1:164610147-164610169 CTGATGGCAAGCAGGGATTTGGG - Intronic
916962509 1:169903582-169903604 CTGGGGGTAAGGAGGAATGGGGG + Intergenic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
919453557 1:197798937-197798959 CTGATGATAAGCAGGGGTGTGGG + Intergenic
920058277 1:203208806-203208828 GTGAGTGTAAGCAGTGATAATGG - Intergenic
920819601 1:209368013-209368035 GTGAGTGTAGTCAGGGATGAAGG + Intergenic
921857676 1:220004562-220004584 CTGAGTGAAAAAAGGGATGAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924576332 1:245284034-245284056 GAGAGGGAAAGGAGGGATGAGGG - Intronic
1062949416 10:1486711-1486733 CTGAGGGTGACCAGGGTTGGTGG + Intronic
1064997791 10:21311786-21311808 ATGAGGGTAAGAAGGACTGAAGG - Intergenic
1066059566 10:31709775-31709797 CTGTCTGTAAGAAGGGATGAAGG - Intergenic
1067438104 10:46292889-46292911 CTGAGGGTCAGCCGGCAGGAAGG + Intronic
1067438122 10:46292972-46292994 CTGAGATGAAGGAGGGATGACGG + Intronic
1067582366 10:47453796-47453818 CTGAGGTGGAGGAGGGATGAGGG - Intergenic
1071875731 10:89841015-89841037 CAGAGAGTTAACAGGGATGAGGG - Intergenic
1073176519 10:101560527-101560549 CTGAGGGTAAGTGGGGGTGGGGG + Intergenic
1074112390 10:110431775-110431797 CTGAGGGTTGGTAGGGATGAGGG + Intergenic
1074362910 10:112837418-112837440 CTGAGGAAAAGCAGGGGTCATGG - Intergenic
1074467331 10:113695224-113695246 CTGAGGGTGAACTGGGAAGAGGG - Intronic
1075178407 10:120187197-120187219 CTGAGTGTAAGCATGGAGGTGGG + Intergenic
1075485169 10:122815756-122815778 ATGTGGTTAATCAGGGATGAAGG - Intergenic
1075605190 10:123800088-123800110 CTGAGGGCAAGCAGGCAAGTAGG - Intronic
1076889174 10:133275596-133275618 GGGAGGGTCAGCAGGCATGAGGG + Intronic
1077253240 11:1569988-1570010 CTGAGGGGAGGCAGGGATGAGGG - Intronic
1077391420 11:2302249-2302271 GTGGGGGTGAGCAGGGGTGAGGG + Intronic
1078428271 11:11268631-11268653 CTGAGGGCAAGAAGGGGTGGTGG + Intergenic
1078878678 11:15425502-15425524 CTTAGGGTAAGCCAGGTTGAGGG - Intergenic
1079138590 11:17792406-17792428 CTGACCGTCAGCAGGGATGGGGG + Intronic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1083792475 11:64994775-64994797 GGGAGGGCAAGCAGGGAAGATGG + Intronic
1083982220 11:66181792-66181814 CTGAGGTAAAGCAGGTATGTGGG - Intronic
1084215891 11:67646693-67646715 CAGAGGGGAAGCAGGAGTGAAGG + Intronic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085968198 11:81554784-81554806 CTGATGGAAATCAGGGATGGAGG - Intergenic
1088135312 11:106550056-106550078 CTGAGGGTAGGCAAAGAAGAGGG - Intergenic
1088212247 11:107469699-107469721 CTGGGGGTGAGCTGGGATAAGGG - Intergenic
1090076666 11:123584206-123584228 CGGAGGGTGGGCAGGGAGGAGGG - Intronic
1090093722 11:123723689-123723711 CTGAGCGTGAGCAGGGAGGTTGG - Intergenic
1091437189 12:481807-481829 CTGTGGGGAAGCCTGGATGAGGG + Intronic
1092643823 12:10547586-10547608 CTGAGGGTTGGCAGGGATGTGGG - Intergenic
1093457476 12:19379126-19379148 CTGGGGGTAGGTAGGTATGAGGG - Intergenic
1095646252 12:44551589-44551611 CTGAGGGTAGGCACTGAAGAAGG - Intronic
1097342008 12:58449543-58449565 CTGAGAATAAGCAGGGATAAGGG + Intergenic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1103352380 12:120293696-120293718 CTGGAGGTAAGTAGTGATGATGG - Intergenic
1103855477 12:123966468-123966490 CTGATGGAAAGCACTGATGAGGG + Intronic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1105556880 13:21455697-21455719 CAGAGGGTAAGATGGAATGAGGG + Intronic
1106553222 13:30789010-30789032 CTGGGTGGCAGCAGGGATGAGGG + Intergenic
1108068979 13:46607949-46607971 CTGAGGGCAGGGAGGGATGTGGG + Intronic
1108167800 13:47711006-47711028 CTGGGGGTTAGGAGGGATGGAGG - Intergenic
1108454342 13:50598043-50598065 GAGAGGGGGAGCAGGGATGAAGG - Intronic
1108497585 13:51040625-51040647 CTGGTGGCAAGCAGGGGTGAGGG + Intergenic
1108691262 13:52861407-52861429 CTGATGGTTAGAAGAGATGAGGG - Intergenic
1110553954 13:76837358-76837380 CAGAGAGCAGGCAGGGATGAAGG - Intergenic
1111166583 13:84465118-84465140 CTTAAGGTAAGCATGGAGGATGG + Intergenic
1111501437 13:89126063-89126085 CTGTGGGGAAGCAGAGAGGAAGG + Intergenic
1111643785 13:91004517-91004539 CTCATGGTAAGCATGGAAGAGGG - Intergenic
1111647701 13:91051449-91051471 GTGAAGGAAAGCAGGGAAGAGGG - Intergenic
1111931601 13:94518305-94518327 CTGAGGGTAAGCAGTGTGGAGGG - Intergenic
1112314547 13:98349941-98349963 CTGCGGCTAAGCACAGATGAAGG - Intronic
1112665787 13:101571601-101571623 GTGAGGGTAAGCAGGGTGCAAGG - Intronic
1114466861 14:22929245-22929267 CTGTGGCCAAGCAGGGGTGAGGG - Exonic
1114495851 14:23131616-23131638 CAGAAGGTAGGCAAGGATGAAGG - Intronic
1114617734 14:24077131-24077153 CTGAGGGCAAGCAGAGAGGGTGG - Intronic
1114662174 14:24354074-24354096 CTGGGGAGAAGCAGGGATGGAGG + Intergenic
1114680960 14:24483047-24483069 GTGAGGTTAAGCTGGGAGGATGG + Intergenic
1114988815 14:28262948-28262970 TTGAGGGTTCGCAGGGAAGATGG - Intergenic
1115884838 14:37959466-37959488 CTGGGGGCAAGCAGAGATCATGG + Intronic
1118338607 14:64876718-64876740 CTGAGGATAAGCAGGAGAGAAGG - Intronic
1118715696 14:68558258-68558280 CTGAGAGAAAGCCGGGAAGAGGG + Intronic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1120515447 14:85464834-85464856 CTGAGGCTAAGCAGGGAAGTGGG - Intergenic
1121092952 14:91195509-91195531 CTGAAGGTATGCAGGGAGGTAGG + Intronic
1121469206 14:94138882-94138904 GTGGGGGTGAGCAGGGCTGACGG + Intergenic
1121890858 14:97589089-97589111 CTGAGGTTAAGCAGGGCAGCAGG + Intergenic
1122099249 14:99394252-99394274 TTGAGGGTAAGGAGGGAGGCAGG - Intergenic
1122316771 14:100830103-100830125 CAGAGGGGAAGAAGGGGTGAGGG - Intergenic
1122855440 14:104557772-104557794 CTCAGGCTCAGCTGGGATGATGG + Intronic
1123097489 14:105773393-105773415 CTGCAGGTAAGCAGGGCTGGTGG - Intergenic
1123146803 14:106141237-106141259 CTGAGTGGGAGCAGGGAGGAGGG - Intergenic
1124604919 15:31162727-31162749 GAGAGGGGATGCAGGGATGAGGG + Intergenic
1124841651 15:33247633-33247655 GTGAGGGTAAGCAGGGGGGCGGG + Intergenic
1125533730 15:40430468-40430490 CTGAGTGTAAGCAGGAGTCACGG + Intronic
1125989433 15:44091855-44091877 CTGAGGGGAAGCAGGGAGAGAGG - Intronic
1128136356 15:65266514-65266536 ATGTGGGGAAGCAGGGATGGAGG - Intronic
1128233671 15:66052687-66052709 CTGAGGGGAGGCCTGGATGATGG - Intronic
1128870909 15:71154621-71154643 CTGCGGGTAAGCAGGAAGGCTGG + Intronic
1129413188 15:75360977-75360999 CTGAGGGAAGGCAGGGCTCATGG + Intronic
1129980554 15:79865643-79865665 CTGAGGGTAAGCAGGGATGAGGG - Intronic
1131013980 15:89042437-89042459 CGGAGGGAAGGCAGGAATGATGG - Intergenic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1132977976 16:2719975-2719997 CTCAGGGGCAGGAGGGATGATGG + Intronic
1134787873 16:16961486-16961508 TTGTGGTTAAGCAGGGAAGAGGG - Intergenic
1136692263 16:32040311-32040333 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1136792759 16:32983540-32983562 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1136877096 16:33870514-33870536 CTGAGTGGGAGCAGGGAGGAGGG - Intergenic
1139664382 16:68446624-68446646 GTGAGGGTTTGCATGGATGATGG - Intronic
1139678555 16:68541988-68542010 CTGCAGATAACCAGGGATGAAGG + Intronic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1203095016 16_KI270728v1_random:1245228-1245250 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1142473595 17:177204-177226 CTCCTGGGAAGCAGGGATGATGG - Intronic
1142613554 17:1122501-1122523 CTGAGCGTGAGCTGGGATGTTGG + Intronic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1144773720 17:17773419-17773441 CTGGGAGCAAGCAGGGATGGAGG - Intronic
1145277353 17:21440536-21440558 GTGAGGGTGAGCTGGGAGGAAGG + Intergenic
1145315191 17:21726431-21726453 GTGAGGGTGAGCTGGGAGGAAGG + Intergenic
1145713622 17:26998367-26998389 GTGAGGGTGAGCTGGGAGGAAGG + Intergenic
1149053867 17:52338994-52339016 ATGAGAGTAAGCAGTGCTGAAGG + Intergenic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1152182013 17:78828427-78828449 CTGAGGGAGAGCTGGGAGGAGGG - Intronic
1152796648 17:82310881-82310903 CTAAGGGGACGCAGGGATAAGGG - Intergenic
1153030540 18:709400-709422 CTGAGGGTAAGGACAGCTGAAGG + Intronic
1153649412 18:7226533-7226555 TTGTGGGTAAGCAAGAATGAGGG - Intergenic
1155417653 18:25617197-25617219 CTGAGAGCAAGCTGGGATGGTGG + Intergenic
1156198467 18:34803131-34803153 CTGGGGGTATGCAGGGATTTAGG - Intronic
1157268603 18:46250910-46250932 TTGAGGGTAATCAGGGAAGCTGG - Intronic
1157584214 18:48790937-48790959 CTGAGGGAGAGCAGGGATTGGGG - Intronic
1157660961 18:49443346-49443368 CTGAGAGTATAAAGGGATGAGGG - Intronic
1157924425 18:51747591-51747613 CTGATGTTCATCAGGGATGATGG + Intergenic
1158902835 18:61982238-61982260 CCCAGGGAAATCAGGGATGAAGG - Intergenic
1159956173 18:74519846-74519868 CTGAAGGCAAGCAGGGCTCAGGG + Intronic
1162561247 19:11419198-11419220 CTGCGGGTCACCAGGGATGCGGG + Intronic
1162687432 19:12399746-12399768 CTGAGGCTGAGGTGGGATGATGG - Intronic
1162691745 19:12439589-12439611 CTGAGGCTGAGGTGGGATGATGG - Intronic
1164670614 19:30070151-30070173 CTGAGGCCAAGCTGGGAGGAGGG - Intergenic
1164703489 19:30302911-30302933 CAGGGGGTAAAAAGGGATGAAGG - Intronic
1165103920 19:33457438-33457460 CTGTGGGCTGGCAGGGATGAGGG + Intronic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165939775 19:39409398-39409420 CTGAGTGTAAGCTGGGATCCTGG + Exonic
1166145153 19:40829182-40829204 TTGAGGGTAAGATGGGAGGAGGG - Intronic
1168296489 19:55379504-55379526 ATGGGGGCATGCAGGGATGAAGG - Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925276465 2:2651668-2651690 CTGTGGGAAAGCAGGGAGGCAGG + Intergenic
925294211 2:2767083-2767105 CAGGGGGTAAGCAGGGGTGTGGG - Intergenic
926004344 2:9361299-9361321 CTCAGGGAAAGCAGGGTTGAAGG - Intronic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
926271741 2:11371936-11371958 CTCAGCGTCAGCAGGGATGGAGG - Intergenic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
926957722 2:18319772-18319794 CTAAAGTTAAGCAGGAATGATGG + Intronic
927042955 2:19247893-19247915 CTGGGGGTGAGCAGAGATGAGGG + Intergenic
927214241 2:20657775-20657797 GAGAGGGTAAGCAGGGCTGCAGG + Intergenic
928401018 2:30978884-30978906 CTCAGGGTAAGCATAGAGGATGG + Intronic
929048816 2:37816742-37816764 CTGAGGTTAGGAAGGGGTGACGG - Intergenic
931574977 2:63709347-63709369 CTGAGGGTAAGAATGGAGGAGGG - Intronic
931969283 2:67567810-67567832 CTGAGAGCAAGAGGGGATGAGGG - Intergenic
932833685 2:75014064-75014086 CTGAGGCAAAGAAGGGTTGAAGG - Intergenic
933834338 2:86233023-86233045 CTGAGGGTAGGGAGGGATCCTGG - Intronic
935390155 2:102542576-102542598 TTGAGGGTAATCAGACATGATGG + Intergenic
935448337 2:103180315-103180337 CAGAGGGGAAGCCGGGAGGAGGG + Intergenic
936145245 2:109976355-109976377 GTGAGGGTCACCTGGGATGATGG - Intergenic
936199440 2:110395123-110395145 GTGAGGGTCACCTGGGATGATGG + Intergenic
938232046 2:129669578-129669600 CTGAGCGGAGGCTGGGATGATGG - Intergenic
940290921 2:152076942-152076964 CAGAGAGTAAGCAGGGAGGGGGG + Intronic
940869062 2:158844657-158844679 AGGTGAGTAAGCAGGGATGAGGG - Intronic
941180047 2:162248563-162248585 CTGAGGGTAAGAAAGGGAGATGG + Intergenic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
941503038 2:166305052-166305074 AAGAGGTTAGGCAGGGATGAAGG + Intronic
942611518 2:177746789-177746811 CTGAGGGTGAGAGGGGAAGAGGG + Intronic
945722484 2:213435388-213435410 GTGAGTGGAAGCAGGGGTGAGGG + Intronic
946379020 2:219332076-219332098 CTGAGGGAAAGCAGGATGGAGGG - Intronic
946879378 2:224161957-224161979 CTCAGAGGAGGCAGGGATGAAGG - Intergenic
948571900 2:238922927-238922949 CTGAGTGCCAGCAGGGAGGATGG - Intergenic
948741434 2:240049027-240049049 CTCTGGGTCAGCAGGGAGGAGGG + Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1169178340 20:3539534-3539556 CTGAGCATAAGCAGGGAGGTGGG + Intronic
1169228447 20:3870854-3870876 ATGAGGGGAAGCAGGGAAGCAGG - Exonic
1169468228 20:5860143-5860165 CTGCGGGTAAGAAGGTAGGAAGG + Intronic
1169535722 20:6537880-6537902 CTGTGAGTGAGCAGGAATGAGGG + Intergenic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1173100911 20:40087615-40087637 CTGATGGCAAGCAGGCATGTGGG + Intergenic
1173302271 20:41814740-41814762 ATGAGGGAAAGCAGAGATGGTGG - Intergenic
1173983312 20:47241544-47241566 GTGAGGGCAGGCAGGGAGGAGGG + Intronic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174106677 20:48167152-48167174 TAGAGGGAAATCAGGGATGAAGG + Intergenic
1175293334 20:57892821-57892843 CGGAGGGTGTGCAGGGATGGAGG - Intergenic
1175751539 20:61501537-61501559 CTGAGATTCAGCAAGGATGAGGG - Intronic
1175890183 20:62312533-62312555 CTGTGGGGAAGCGGGGATGCGGG + Intronic
1175926019 20:62472045-62472067 CTGAGGTTAAGAAGGGGTTAGGG - Intronic
1178276473 21:31242498-31242520 CTCAGTGAAAGCAGAGATGAAGG + Intronic
1178485988 21:33020396-33020418 CTGATGGCTAGCAGGGAGGAGGG + Intergenic
1178722315 21:35020954-35020976 CTGAAGGTAAGTGGAGATGATGG - Intronic
1179010904 21:37555361-37555383 CAAAGGTTAAGCAGGGAAGAGGG - Intergenic
1179232299 21:39515776-39515798 ATGATGGTAAGGAGGGATGATGG + Intergenic
1179902675 21:44402096-44402118 CCGAGGGAAAGCAGGGAAGCAGG - Intronic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1181149889 22:20875620-20875642 CACAGGGGAAGCCGGGATGAAGG + Intronic
1183307500 22:37090400-37090422 ATGAGGAGAAGAAGGGATGAGGG + Intronic
1183321366 22:37167060-37167082 CTGGGGGTTAGGTGGGATGAGGG - Intronic
1184095212 22:42312696-42312718 CTGAGGCTCAGCAGGGATGGGGG - Intronic
1184294769 22:43516439-43516461 CTGACGGCAAGCACGAATGAAGG - Intergenic
950494241 3:13324235-13324257 CTGAGGGTGGACAGGGAGGAAGG - Intronic
950694083 3:14684109-14684131 CCTAGGGTATGCAGGGGTGAGGG - Intronic
951200184 3:19867950-19867972 CTGAGAGTAAGAAAGGAGGAGGG - Intergenic
951637324 3:24793973-24793995 CTGAGGGTCAGCAGGAGTGCAGG - Intergenic
953082869 3:39637208-39637230 CTGAAGGCCAGCAGGGTTGAAGG + Intergenic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
958173329 3:89964179-89964201 ATGAGAGAAAGCAGGGATGTTGG - Intergenic
958477695 3:94605633-94605655 CAGAGGTTAAGAAGGGAGGAAGG - Intergenic
959714452 3:109417290-109417312 CTGAGGGTAATTATGGTTGAGGG - Intergenic
961077595 3:123996371-123996393 CTGGGGCTGAGCAGTGATGATGG + Intergenic
961306983 3:125964909-125964931 CTGGGGCTGAGCAGTGATGATGG - Intergenic
961591859 3:127987121-127987143 CTGAAGGGAAGCAGGCATCAAGG + Exonic
962345041 3:134612454-134612476 CTGAGGGGATGCAAGGCTGAGGG + Intronic
962676436 3:137761802-137761824 GGGAGGGAACGCAGGGATGAGGG - Intergenic
963513634 3:146279994-146280016 CAGAGGGTCAGCAGGAATGAGGG + Intergenic
964212088 3:154239794-154239816 CTGAGCCTAAGCAGGAATGGAGG + Intronic
965053173 3:163678264-163678286 CTGAGGATAAGCTGATATGATGG + Intergenic
965341851 3:167501106-167501128 ATGGAGGAAAGCAGGGATGAGGG + Intronic
966130116 3:176627828-176627850 TTGAGGCTAATCAGGGATAATGG + Intergenic
966564216 3:181358343-181358365 CTGGTGGTGAGCAAGGATGATGG - Intergenic
966790950 3:183668918-183668940 CTTAGAGTAGGAAGGGATGATGG + Intronic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
967099113 3:186201312-186201334 CTGGGGGCCAGCAGGGATCATGG + Intronic
968712196 4:2127124-2127146 CGGAGGGTAGGGAGGGGTGAGGG + Intronic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
974349380 4:60724671-60724693 CTGGGGGAAAGCAGGGAATAAGG - Intergenic
975892376 4:79045080-79045102 CTGAGAGAAAGCAGCGATGAGGG + Intergenic
976564380 4:86537025-86537047 AGGAGGGTACGCAGGCATGAGGG + Intronic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978867000 4:113524913-113524935 ATGTGGGTAAGAATGGATGAAGG + Intronic
979992906 4:127396453-127396475 CTGAGGGTTGGCAGGCATGTTGG + Intergenic
980279454 4:130700646-130700668 GGGAGGGTAAGGGGGGATGAAGG - Intergenic
981389562 4:144172887-144172909 CTATTGGTAAGCAGGGTTGAAGG + Intergenic
981609424 4:146577674-146577696 ATGAGAGTAAGCAGGTAGGAGGG + Intergenic
981835746 4:149051150-149051172 CTGAAGGTAAGCAGAGCTTAAGG - Intergenic
983026364 4:162741730-162741752 CAGAGGGAAATCAGAGATGATGG - Intergenic
983123807 4:163923541-163923563 CTTAGGATAAGCAAGGAAGAAGG + Intronic
984059608 4:174975853-174975875 CTGAGGGAAACCAGGGATTCTGG - Exonic
984784284 4:183553787-183553809 ATGAGGGTAAGCATGGGTGAGGG + Intergenic
985790816 5:1926154-1926176 CTGGGGGTTAGCAGGGCTGGAGG - Intergenic
985836335 5:2274828-2274850 CCGGGGGTCAGCAGGGAGGAGGG + Intergenic
986631861 5:9781836-9781858 GTGAGGATAGGCAGGGATGATGG - Intergenic
987049170 5:14135279-14135301 CTGAGGGCAAGCCGGGAAGGGGG - Intergenic
988450413 5:31336909-31336931 CTTAGGGCAAGAAGGGAAGAGGG + Intergenic
988683608 5:33506290-33506312 CTGAGTTTAAGCAAGGGTGAAGG - Intergenic
994085958 5:95759108-95759130 CGGAGGGCAGGCAGGCATGATGG + Intronic
994458752 5:100048080-100048102 CTGAGGGGAGTCAGGGGTGAAGG + Intergenic
994874618 5:105402625-105402647 ATGACAGTAAGCAGGGAAGAGGG - Intergenic
995554261 5:113311478-113311500 CTGAGGATAAGCTGGCTTGATGG - Intronic
997570798 5:134925754-134925776 CTGAGGGGAGTCAGGGGTGAAGG + Intronic
997598411 5:135122604-135122626 ATGAGGCTAAGCAGAGAGGAAGG - Intronic
997872441 5:137517283-137517305 CTCAGGAAGAGCAGGGATGATGG + Intronic
997872455 5:137517374-137517396 TTCAGGAGAAGCAGGGATGATGG + Intronic
997872482 5:137517499-137517521 CTCAGGAGAAGCAGGGATGATGG + Intronic
998055662 5:139074773-139074795 CTGAAGGCAAGAGGGGATGAAGG - Intronic
998483136 5:142479584-142479606 CTGAGGAGAAGCAGGAATTAAGG + Intergenic
1001296694 5:170503892-170503914 ATGAGGGTGCGCAGGGGTGAGGG + Intronic
1002690851 5:181049553-181049575 CTGAGGGTGAGGTGTGATGACGG + Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1004495566 6:16159773-16159795 CTGAGGGTCAGCAAGAAGGATGG + Intergenic
1004945409 6:20607026-20607048 CTGGTAGTAAGCAGGGATTATGG + Intronic
1006598110 6:35208370-35208392 CTGAGGGACAGCAAGGGTGAAGG - Intergenic
1006682351 6:35806077-35806099 CTGCGGGTAAGCAGAGATGGTGG + Exonic
1007417771 6:41702144-41702166 CTGAGGGTGACATGGGATGAGGG - Intronic
1007533627 6:42564654-42564676 CTGGGGGAAAGGAGGTATGATGG - Intronic
1008029201 6:46674087-46674109 CTCAGGGTCAGGAGGGATGAGGG + Intronic
1008715792 6:54288345-54288367 CTGAGTCTGAGCAGGGATGAGGG + Intergenic
1010558760 6:77320990-77321012 CTGAGGGTAAGAACGTATTATGG - Intergenic
1012690110 6:102299895-102299917 CTCAGGGTCTGCAAGGATGAAGG - Intergenic
1013069653 6:106716844-106716866 TTGAGGGTTAGCAGGGATATAGG - Intergenic
1015385101 6:132613369-132613391 ATGAGGAAAAGCAGGGAGGAAGG - Intergenic
1015440004 6:133237054-133237076 CTGAGTGTAAGCATGGAAGAAGG + Intergenic
1015483408 6:133741266-133741288 CTGAGGCTAAGAGGGGCTGAGGG + Intergenic
1018248724 6:161846866-161846888 CTTAGAATAAGCAGGAATGATGG + Intronic
1018365476 6:163115984-163116006 GGGAGGGCAAGCAGGGATTAAGG - Intronic
1018847161 6:167563657-167563679 ATGAGGGAATGCATGGATGAAGG - Intergenic
1019065112 6:169289857-169289879 CTGGGGGTAAGCAGGTGCGAAGG + Intergenic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1019106470 6:169671649-169671671 GTGAGGGTGAGAAGGGATGAAGG - Intronic
1019143935 6:169964824-169964846 CTGAGGGTGAGCAGGGGTGAGGG + Intergenic
1019437780 7:1030830-1030852 CTGTGGGAAAGCAGGCATGGTGG - Intronic
1019714272 7:2531103-2531125 CAGAGGGAAAGCAGGGACCAGGG + Intergenic
1019785876 7:2977117-2977139 CTGGGGGGAGGCAGGGATGGAGG + Intronic
1023598346 7:41855933-41855955 GTGGGGGCAGGCAGGGATGAAGG - Intergenic
1024531301 7:50394609-50394631 CTGAGGCTCAGAAGGGGTGATGG + Intronic
1025082394 7:55995185-55995207 CTGAAAGTGAGTAGGGATGATGG + Intronic
1026258829 7:68736587-68736609 CTGAGGGGAGTCAGGGGTGAAGG - Intergenic
1029181291 7:98703905-98703927 CCGATGGGGAGCAGGGATGAAGG - Intergenic
1029548523 7:101223907-101223929 CAGAGGGGAAGCCAGGATGAGGG - Intronic
1030566423 7:111163648-111163670 ATGAGGGTAGGAAGGGATAAGGG + Intronic
1031070360 7:117154918-117154940 GGGAGTGTAAGAAGGGATGATGG + Intronic
1031468969 7:122146686-122146708 CTGAGTGTATGCAGGGATAAAGG + Intergenic
1031972284 7:128073520-128073542 CAGAAGGTTAGAAGGGATGAGGG - Intronic
1032698775 7:134360536-134360558 TTGTGGGGAAGCAGGAATGAGGG - Intergenic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG + Intergenic
1034045696 7:147924669-147924691 CTGAAAGTAAGCCGGGAAGATGG + Intronic
1034554726 7:151842657-151842679 GTGAGGGTAGGTAGTGATGATGG + Intronic
1034554731 7:151842682-151842704 GTGATGGTAGGTAGGGATGATGG + Intronic
1034591746 7:152146351-152146373 CTGGAGGCAAGCAGGGGTGAAGG - Intronic
1037810088 8:22081753-22081775 CAGAGGGTGAGGAGGAATGAGGG + Exonic
1037880449 8:22571098-22571120 CTGAGGGGGAGCTGGGGTGACGG - Exonic
1038177486 8:25194452-25194474 CGGAGGGAAGGCAGGGAGGATGG - Intronic
1039360389 8:36870423-36870445 CTGAGAGTAAAAAGGGAGGAAGG - Intronic
1039408836 8:37335098-37335120 GTGAGCGTAAGCACGGAGGAGGG + Intergenic
1042397007 8:68304577-68304599 CAGAGGGTAGGCAGGGTTCAGGG + Exonic
1043088247 8:75865077-75865099 ATGAGGGTCAGGAGGGATGGAGG - Intergenic
1043438489 8:80256578-80256600 CTGAGGGTGACCAAGAATGAGGG - Intergenic
1043684027 8:83065896-83065918 CTAAGGGGAAGCAGGGCTGGAGG - Intergenic
1047718914 8:127620534-127620556 CTGAGGTGGAGCGGGGATGAAGG + Intergenic
1047722832 8:127657676-127657698 CAGAGGGAAGGCAGGGAAGAAGG + Intergenic
1047802184 8:128321485-128321507 GTGAGGGTGTGCAGGGGTGAGGG + Intergenic
1048348317 8:133595332-133595354 CTGATGGGAAGTAGGGCTGATGG - Intergenic
1048528892 8:135229494-135229516 CTGAGTGTCAGGAGGGATTACGG + Intergenic
1048598508 8:135892898-135892920 CTGAGGTTGAGCTGGGCTGAGGG - Intergenic
1048636959 8:136307250-136307272 CTTAAGGAAAGCAGGGATGGGGG - Intergenic
1049807108 8:144546074-144546096 CTGAGGGTGAGGCGGGAGGAAGG + Intronic
1050461530 9:5881474-5881496 TTGATGCTAAGCAGGGAAGAGGG + Intergenic
1050680845 9:8109663-8109685 TTGAGGGTAATGAGGAATGAGGG - Intergenic
1051662081 9:19435092-19435114 CTAAGGGTAGGCAGGAATGATGG - Intronic
1051798079 9:20898696-20898718 GTAAGGATAAGCAGGGATGCTGG - Intronic
1054152605 9:61617651-61617673 CTTGGGAGAAGCAGGGATGAGGG - Intergenic
1054180983 9:61909190-61909212 CTTGGGAGAAGCAGGGATGAGGG + Intergenic
1054656608 9:67671952-67671974 CTTGGGAGAAGCAGGGATGAGGG - Intergenic
1054734570 9:68737576-68737598 CTCAGGGTTAGCAGGGTTGAAGG + Intronic
1055382968 9:75729227-75729249 CTGAGGTTATGCATGAATGAAGG - Intergenic
1056243207 9:84669572-84669594 CTGGGGGCGAGCAGGGAGGAGGG - Intronic
1057141092 9:92727255-92727277 CTGAGGGTATGCAGTGATTAGGG - Intronic
1057746085 9:97752454-97752476 TTGAGAGTGAGCAGGGAAGAGGG + Intergenic
1057946421 9:99333525-99333547 CTGGGGGTACTCAGGGATGCTGG + Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1059429218 9:114240197-114240219 CTGAGGGGAAGCAGAGAGCAGGG - Intronic
1059836699 9:118162827-118162849 CTAAGGGTAGGCAAGGTTGAAGG + Intergenic
1060207142 9:121688828-121688850 CGCAGGGTGAGCAGGGAAGAGGG + Intronic
1060810680 9:126610158-126610180 CTGAGGCTTGGCAGGGCTGATGG + Intergenic
1185780797 X:2843155-2843177 CTGAGGGACAGCAGGGGTGACGG - Intronic
1186344569 X:8678609-8678631 CTGAGGGTCAGAAGGAATAATGG - Intronic
1186564138 X:10644364-10644386 CTGAGAGGAAGGAGGAATGAAGG - Intronic
1188107810 X:26164496-26164518 CTGACCCTAAACAGGGATGACGG + Intergenic
1188111197 X:26197718-26197740 CTGACCCTAAACAGGGATGACGG + Intergenic
1189185606 X:39052274-39052296 CTGAGGGCAAGCAGGTTTCAGGG + Intergenic
1196145856 X:112316084-112316106 CGGAGGGTTGGAAGGGATGAAGG - Intergenic
1196414356 X:115454972-115454994 CTGGGGGCAAGCAGGGGTGCAGG - Intergenic
1197907585 X:131442842-131442864 CTGGGGCTAAGCAGGGGAGAAGG + Intergenic
1197911838 X:131491388-131491410 CTGGGGCTAAGCAGGGGAGAAGG + Intergenic
1197971388 X:132118841-132118863 CTGTGGGGGAGCAGAGATGAAGG - Intronic
1201742373 Y:17337613-17337635 CTGGGGGTCAGCAGGGCTGAAGG + Intergenic
1201849535 Y:18462748-18462770 GTGAAGGTAAGCAGAGAAGATGG - Intergenic
1201883783 Y:18857627-18857649 GTGAAGGTAAGCAGAGAAGATGG + Intergenic