ID: 1129981172

View in Genome Browser
Species Human (GRCh38)
Location 15:79872616-79872638
Sequence GGGCAGGTCAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 4, 1: 11, 2: 20, 3: 46, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129981167_1129981172 3 Left 1129981167 15:79872590-79872612 CCACATTTGGCTATATGTAAATT 0: 1
1: 1
2: 2
3: 33
4: 379
Right 1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG 0: 4
1: 11
2: 20
3: 46
4: 150
1129981166_1129981172 4 Left 1129981166 15:79872589-79872611 CCCACATTTGGCTATATGTAAAT 0: 1
1: 0
2: 0
3: 17
4: 246
Right 1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG 0: 4
1: 11
2: 20
3: 46
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129981172 Original CRISPR GGGCAGGTCAATGCAAATTG AGG Intronic
900541294 1:3204279-3204301 GGGGAGGGCAGTGGAAATTGGGG + Intronic
901074921 1:6548074-6548096 GGCCACGCCAATGCAAATTTTGG - Intronic
901459459 1:9383066-9383088 GGGCAGCTAAATGCACACTGAGG + Intergenic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906499874 1:46333820-46333842 AAGCAGGCTAATGCAAATTGAGG - Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
915812011 1:158923131-158923153 GGGTAGGTGACTGCAAAGTGAGG + Intergenic
920636741 1:207711584-207711606 GGGCACATCAATGCAAATTGAGG - Intronic
921802405 1:219416615-219416637 AGGTTGATCAATGCAAATTGAGG + Intergenic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
923995896 1:239494090-239494112 AGGCAGGTTAATTCAAATTGAGG + Intronic
924273050 1:242354306-242354328 GGGTGGATCAATGCAAATTCAGG - Intronic
1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG + Intergenic
1063966825 10:11352513-11352535 GGCCAGGTTAATGCAAACTGAGG + Intergenic
1064800469 10:19064954-19064976 GAGCAGATTAATGCAAATTGAGG + Intronic
1065827616 10:29586210-29586232 AGGCTGGTTAATGCAATTTGAGG + Intronic
1065950257 10:30645079-30645101 AGGCTGGTTAATGCAATTTGAGG - Intergenic
1066711662 10:38242353-38242375 GGGTGGATCAATGCAAATTCAGG + Intergenic
1067811012 10:49427263-49427285 AGGCATGTCATTTCAAATTGTGG - Intergenic
1068685667 10:59867904-59867926 GGGCAGGACAACTCAAAGTGGGG - Intronic
1069065857 10:63941339-63941361 GGGCAGCTGGATGCAGATTGTGG + Intergenic
1072631949 10:97152282-97152304 GGGAAGGTCCCTGCAAATTGAGG + Intronic
1072704910 10:97674170-97674192 TGTCAGGTCTATGCAAATTTAGG - Exonic
1073396012 10:103218196-103218218 AGGCAGGACAATTCAAAGTGAGG + Intergenic
1074258689 10:111830204-111830226 GGGCAGGGCAACACAAAGTGTGG - Intergenic
1074733384 10:116401418-116401440 TGGCAGGTCAAAGGAAAGTGAGG + Intergenic
1076125944 10:127974016-127974038 GGGCAGGACCATGCTAAGTGTGG - Intronic
1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG + Intronic
1078002573 11:7509776-7509798 AGCCAGGTCAATGTAAGTTGAGG - Exonic
1079820926 11:25127297-25127319 GGTCAGATCAATCCAACTTGTGG - Intergenic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1081368269 11:42264065-42264087 AGGCAGATTAATGCCAATTGTGG - Intergenic
1082991883 11:59213591-59213613 GCTTAGGACAATGCAAATTGGGG - Intergenic
1083265407 11:61544551-61544573 GGGCAGGTCAAGGCAGAGGGAGG + Intronic
1083283986 11:61646034-61646056 GGGCAGGTCTAAGCCAATTTGGG - Intergenic
1086554424 11:88091926-88091948 AGGCACGTCAATGGAAATTGAGG + Intergenic
1088234137 11:107704398-107704420 GGGCAGCTCAATGCCAATACAGG + Intergenic
1093941401 12:25058890-25058912 GCAAAGGTGAATGCAAATTGTGG + Intronic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1096709524 12:53444982-53445004 GGGCAGTTAAATGTAAATGGAGG - Intronic
1100811092 12:98339029-98339051 GGGCAGGTGAAAGAAAAATGTGG + Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1104785327 12:131444875-131444897 GGGGAGCTCACTGCAAGTTGAGG - Intergenic
1105035141 12:132913968-132913990 GGGCAAATCAATGAAAATAGTGG - Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1107095828 13:36534044-36534066 GGGCAGGTTGCTGCAGATTGTGG + Intergenic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1109256963 13:60095430-60095452 GGGTGGGTCAATGTAAATTAAGG + Intronic
1109895704 13:68686286-68686308 GGGCAGGACAACTCAAACTGGGG + Intergenic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1111034732 13:82657472-82657494 AGGCAGGACAATTCAAAGTGGGG + Intergenic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1111508886 13:89233754-89233776 GGACAGGTGAAGGCAAATTCTGG - Intergenic
1111663843 13:91243233-91243255 GGGTAGGTTGATACAAATTGAGG + Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112582487 13:100688435-100688457 GGGCAGATTAATGCACATTGGGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1112966093 13:105196055-105196077 GGTCAGGCTAATACAAATTGAGG + Intergenic
1114850634 14:26378839-26378861 GAACAGGTCAGTGCAAATTGAGG + Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1120246960 14:82018786-82018808 GGGAAGATCAATACAAATTTTGG - Intergenic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1121513993 14:94536843-94536865 GGGCAGTTTAGTGCAAATTGAGG + Intergenic
1123093783 14:105755112-105755134 TGGCAGGACAATTCAAAGTGGGG - Intergenic
1123835205 15:24182977-24182999 GGGCAAGTCAAGGCAAATTGAGG + Intergenic
1123849961 15:24344332-24344354 GGGGCAGTCAATGCAAATTGAGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1124156106 15:27226382-27226404 GTCCAGGTCAAAGCAAATCGCGG + Intronic
1126942386 15:53780869-53780891 GGGCACGTTAATGCAAAAGGCGG + Intergenic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1131309296 15:91273208-91273230 GGCCAGGTCAATGCAGCTTCTGG + Intronic
1131849112 15:96518862-96518884 GGAAAGGTCAAGGAAAATTGGGG + Intergenic
1133475235 16:6114968-6114990 GGACAAGTTAATGCAAACTGAGG + Intronic
1133512583 16:6474053-6474075 GGGCTGGTTACTGCAAACTGTGG + Intronic
1135226143 16:20659927-20659949 AGGCAGGACAATGCAAAGCGGGG - Intronic
1137577825 16:49615257-49615279 CGGCAGGCAAATGCAAATTTCGG + Intronic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1139102900 16:63789611-63789633 GGGATGATCAATGCAAATTGTGG + Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1142664557 17:1455564-1455586 GGGCAGGGCAAGGCAACGTGGGG - Intronic
1144303056 17:13941310-13941332 AGGTGAGTCAATGCAAATTGAGG + Intergenic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1145293308 17:21567466-21567488 GGGCAGGACAACTCAAAGTGGGG + Intronic
1145747435 17:27330848-27330870 GGGCAGGACAATTCAAAGTAGGG + Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1147344453 17:39779739-39779761 GGGCAGGTGAGGGCAAACTGTGG - Intronic
1148102009 17:45098030-45098052 GGGCAGGTCAAGGCAATTCTAGG - Intronic
1148227219 17:45907267-45907289 GGTCAGGTCAATTTAAATAGGGG - Intronic
1153833526 18:8944060-8944082 GAGCTGGTCACTGCAGATTGTGG - Intergenic
1154023649 18:10686726-10686748 GGGCAGGTCCATGGAAACAGAGG + Intronic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1156400905 18:36739226-36739248 AGCCAGGTCAACACAAATTGAGG - Intronic
1157482251 18:48062931-48062953 GAGCAGGTGAAGGCAAAATGCGG - Intronic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159246992 18:65819232-65819254 GAGTGGGTCAATGCAGATTGAGG - Intronic
1159337062 18:67081956-67081978 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1159337072 18:67082029-67082051 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1164394769 19:27852845-27852867 GGGCAAGTCAAAGCAGCTTGGGG + Intergenic
1165134738 19:33660703-33660725 AGGCAGGTTAATGCAAATCAAGG - Intronic
927209768 2:20631914-20631936 GGGCAGGTTACTGCAGACTGTGG - Intronic
930683221 2:54279989-54280011 GGGAAGATAAATGCAAGTTGTGG + Intronic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
930903092 2:56532038-56532060 GGGCACATCAGTACAAATTGAGG + Intergenic
931654526 2:64498959-64498981 GGGCAGGACAACTCAAAGTGGGG + Intergenic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
932748645 2:74356562-74356584 AAACAGGTGAATGCAAATTGTGG + Intronic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
934918143 2:98317661-98317683 AGGCAGGACAATTCAAAGTGGGG - Intergenic
940748452 2:157597212-157597234 GGGCAGGTTAATGCACATGCAGG - Intronic
942216421 2:173724312-173724334 GGCCAGGTAAATGTAAATTTTGG - Intergenic
943544622 2:189259428-189259450 GGACAAGTCAATTAAAATTGAGG - Intergenic
946653735 2:221921981-221922003 GGTCAGAGCAATACAAATTGTGG - Intergenic
1168879044 20:1190931-1190953 GAGTAGGTCAATGCCAAGTGTGG + Intergenic
1168909418 20:1435227-1435249 GGGCAAGCCAATGCAAACTGAGG - Intergenic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1170036133 20:11992184-11992206 GGGAAGGCCAAGGCAAATGGGGG - Intergenic
1170478788 20:16744448-16744470 GGGAGGCTCAATACAAATTGAGG + Intergenic
1171325011 20:24283460-24283482 GGGCAGGTCAATACAAATTAAGG + Intergenic
1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG + Intronic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1173150834 20:40565425-40565447 GTGCAGGGGAATGCAAAGTGAGG + Intergenic
1173308103 20:41871170-41871192 GAACAGGTCAATGCAAATTGAGG - Intergenic
1173702287 20:45083369-45083391 GGGCAGGTTACTGCAGGTTGTGG + Intergenic
1173891978 20:46519782-46519804 GAGTGGATCAATGCAAATTGAGG - Intergenic
1175250795 20:57609200-57609222 GGGCAGGTCCACGCAAGGTGGGG - Intronic
1176184566 20:63771287-63771309 GGGCAGCTCATTGCAGCTTGTGG - Intronic
1177355761 21:20004702-20004724 GGATGAGTCAATGCAAATTGAGG - Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1178118029 21:29437173-29437195 AGGCAGGACAATGCTAAGTGGGG + Intronic
1178171026 21:30039923-30039945 GGGCAGGTCAAAGCTAGGTGGGG + Intergenic
1185005667 22:48275314-48275336 GGGCAGGTGTAAGCAAATCGTGG + Intergenic
1185242915 22:49755981-49756003 GGATGGGCCAATGCAAATTGAGG - Intergenic
949263974 3:2135659-2135681 GGGCTGGTCAATGCAGATGAAGG + Intronic
950071441 3:10155959-10155981 TGGCAGGTCACAGAAAATTGAGG + Intergenic
950670572 3:14522956-14522978 GGGCAGGTCAGTGCAGTGTGTGG + Intronic
950779379 3:15378222-15378244 GGGCAAGCTGATGCAAATTGAGG + Intergenic
952013172 3:28925963-28925985 GAGCAGGTCAATGAAAATAGAGG - Intergenic
952496194 3:33917802-33917824 GGGCAGCCCACTGTAAATTGTGG - Intergenic
956722445 3:72130200-72130222 GGGCATTTCACTGCAAATTTGGG + Intergenic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
959876847 3:111393162-111393184 GGACAGGTCAATGCACACTGAGG - Intronic
960535862 3:118813689-118813711 GGGCAGGCAAATGGAAATGGGGG - Intergenic
960644707 3:119866534-119866556 GGGCAGGTCTATAAAACTTGGGG - Intronic
963745734 3:149123780-149123802 GGCCAGACCAATGCAATTTGAGG - Intergenic
963921897 3:150913775-150913797 GGTTAGATCAAGGCAAATTGTGG + Intronic
966209009 3:177433580-177433602 GGGTAGGTCAGTGGAAAGTGTGG + Intergenic
967507817 3:190272936-190272958 GGGCAGGTTGCTGCAAATCGTGG + Intergenic
967983489 3:195079078-195079100 GGGCCGGGAGATGCAAATTGAGG - Intronic
969218466 4:5743014-5743036 GGGCAGTTCATTGCAAATTGAGG + Intronic
969834191 4:9825942-9825964 GGGCAGGTCAAGGCTGCTTGTGG + Intronic
970522943 4:16903735-16903757 AGGCAGGTAAATGGAAATTAGGG - Intergenic
970673316 4:18419992-18420014 GGTCTGGGCAATGCAAATTGTGG - Intergenic
971156814 4:24091970-24091992 TGGCAGAACAATGCAAATTCTGG - Intergenic
971644148 4:29174802-29174824 TGGCATATCAATGCAAACTGTGG + Intergenic
971854334 4:32024465-32024487 GGGTATGTCAATGCGAACTGAGG + Intergenic
972441653 4:39099383-39099405 GGGGAGATCAATGCATATTGAGG - Intronic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
974836423 4:67256680-67256702 GAGTAGTTCAATGCAAATTTAGG + Intergenic
976775609 4:88702926-88702948 GGGCAGGTTGCTGCAGATTGTGG - Intronic
981176803 4:141691694-141691716 GGGCAGGCTAATGCAAAGGGTGG + Intronic
981890049 4:149725769-149725791 TGGCAGGTCTATGGAGATTGAGG - Intergenic
983811829 4:172072083-172072105 GGGCAGGTTGCTGCAGATTGTGG + Intronic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985284068 4:188316597-188316619 GGACAGTCCAATGCAAACTGAGG - Intergenic
985700465 5:1368840-1368862 GGACAGGTCAATGCAAATTAAGG - Intergenic
985701433 5:1375487-1375509 GTAGAGATCAATGCAAATTGAGG - Intergenic
987908588 5:24112054-24112076 GGGGAGGTCAGTGCATATGGAGG + Intronic
988921390 5:35945963-35945985 GGGCGTGTCACAGCAAATTGGGG - Intergenic
989311324 5:40022121-40022143 AGGCATGTCAATGCAAATTTAGG + Intergenic
992558742 5:77929361-77929383 GGGAAGGGCAATGCAGTTTGGGG + Intergenic
992779356 5:80114027-80114049 GGGCAGGTCATTGTTAATTGAGG - Intronic
996870519 5:128187178-128187200 GGGCAGGTTAATCAAAAATGGGG + Exonic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
998847482 5:146325074-146325096 AGGCAGGTGAATCCAGATTGAGG - Intronic
1000304747 5:159984986-159985008 GGGCAGACCATTGCAAAGTGTGG - Intergenic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1007310308 6:40940094-40940116 GGGGAGGTCACTACAACTTGTGG + Intergenic
1010616605 6:78020566-78020588 GGGCAGGTTAATATGAATTGAGG - Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1010986026 6:82425333-82425355 TGGCAGGTCTATCCAAATGGTGG - Intergenic
1012318082 6:97805477-97805499 GGGCATGCCAGTACAAATTGTGG + Intergenic
1014480363 6:121928372-121928394 GGGCTGATTAATGCTAATTGTGG - Intergenic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1018415618 6:163599998-163600020 GAGCGGGTCAATGTAAAGTGAGG - Intergenic
1018623260 6:165751802-165751824 GGACAGGTGCATGCAAATTGAGG - Intronic
1019029090 6:168995046-168995068 GGGCGGGCCAATGCCAATGGAGG + Intergenic
1019954337 7:4401433-4401455 GGGTAGGTCAATGCAAGCTGAGG + Intergenic
1021432914 7:20581940-20581962 GGGCAGGGCAAGGCAGAATGGGG + Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1024887419 7:54160500-54160522 GGGCAGGACAACTCAAAGTGGGG + Intergenic
1026076809 7:67179167-67179189 GGGCAGGCCAATGCAAATAAAGG + Intronic
1026700053 7:72633172-72633194 GGGCAGGCCAATGCAAATAAAGG - Intronic
1028035407 7:85975474-85975496 GGGCAGCTCAATGCAAAGTGAGG + Intergenic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1030776765 7:113543307-113543329 GGACGAGTCAATGCAAATTGAGG - Intergenic
1033212797 7:139472734-139472756 GGGCTTCTCAATTCAAATTGGGG - Intronic
1039157654 8:34579691-34579713 TGGCAGATCAATGTAAATTGAGG - Intergenic
1041777243 8:61536830-61536852 GGGCAGGTTACTGCAGGTTGTGG + Intronic
1043524978 8:81086742-81086764 AGCCAGGGAAATGCAAATTGAGG + Intronic
1044887383 8:96793920-96793942 GGTCATGCCAATGCAAAATGTGG + Intronic
1045288943 8:100815584-100815606 GGGCAGTTTAATGTAAGTTGGGG - Intergenic
1048851127 8:138646446-138646468 GGGCAGGTCACTTCAATGTGTGG - Intronic
1049222654 8:141434993-141435015 GGGCTGGGCAAGGCAAACTGGGG - Intergenic
1050584132 9:7092450-7092472 GGTCAGATTAATGCAAAATGAGG - Intergenic
1050587989 9:7133032-7133054 GGGCTGTGCAATGCAAACTGAGG + Intergenic
1051011160 9:12416231-12416253 GGGCGAGTCAAAGCAAATTAAGG + Intergenic
1052050871 9:23848887-23848909 GGGCAGGTCCATTCCAATTTAGG + Intergenic
1054799728 9:69335365-69335387 GGGCAGGTGACTGCTAAATGGGG + Intronic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1058310618 9:103497056-103497078 GGTCAGGCCAATGCAAATCAAGG + Intergenic
1189910148 X:45802790-45802812 GGACACCTCAATCCAAATTGAGG - Intergenic
1190364636 X:49680108-49680130 GGGTCAGTCAATGCAAATTGAGG + Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1191882614 X:65857655-65857677 GGACTGGTCAATGCAAAGTGTGG + Intergenic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1198441367 X:136666612-136666634 GGGAAGGTCACTGGAAATTGAGG - Exonic
1199561899 X:149172194-149172216 GGGCATGATAATGCAAATGGTGG + Intergenic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1201693736 Y:16799713-16799735 AGGCAGGACAATTCAAAGTGGGG - Intergenic