ID: 1129981769

View in Genome Browser
Species Human (GRCh38)
Location 15:79878709-79878731
Sequence TCCCTATGTGGAGGGAGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 1, 2: 22, 3: 59, 4: 301}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129981769 Original CRISPR TCCCTATGTGGAGGGAGTGG TGG Intronic
900149306 1:1171251-1171273 TCCTTGTGTGGGGGGAGAGGGGG - Intergenic
900460413 1:2799975-2799997 ACCATGTGGGGAGGGAGTGGCGG + Intronic
900471151 1:2855583-2855605 TCCCTGAGTGGAGGGGGAGGCGG - Intergenic
900479480 1:2891206-2891228 CCTCTTTGTGGAGGGGGTGGGGG - Intergenic
901065380 1:6491703-6491725 TGCGTGTGTGGAGGGAGGGGTGG - Intronic
901148457 1:7084432-7084454 TCCTTCTGGGGAGGGAGTGGGGG + Intronic
901668446 1:10839626-10839648 GCCCTGTGGGGTGGGAGTGGAGG + Intergenic
901787532 1:11634562-11634584 TCCCTCTGTGAGGGCAGTGGTGG + Intergenic
902364581 1:15963505-15963527 TCCCTCTGGGGATGGGGTGGAGG - Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902661904 1:17910076-17910098 TATCTATATGGAGGGAGGGGAGG + Intergenic
903163748 1:21507173-21507195 TCCCGAGGTGGAGGGACTTGAGG + Intergenic
903185471 1:21626525-21626547 TCCCCAAGAGGAGGGAGAGGAGG + Intronic
903402302 1:23063838-23063860 TCCTTATGGGGTGGGAGTGGGGG + Intronic
905384644 1:37593654-37593676 CTCCTATTTGGAGGAAGTGGGGG + Intronic
906692202 1:47799883-47799905 TTGCTATGAGGATGGAGTGGAGG - Intronic
908095146 1:60729850-60729872 TCCAGAAGTGGAGAGAGTGGGGG - Intergenic
908357304 1:63335480-63335502 GCCCTCAGTGGAGGGGGTGGGGG - Intergenic
910301204 1:85708969-85708991 TCCCTAAGGGAAGGGGGTGGTGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
911889380 1:103347668-103347690 TCCCTATGGGGTGGTGGTGGGGG + Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912762312 1:112379963-112379985 TCCATCTGGGGTGGGAGTGGAGG - Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915489414 1:156242962-156242984 GCCCCATGTGTAGGGAGAGGAGG + Intronic
915601466 1:156925278-156925300 AACCTCTGGGGAGGGAGTGGAGG - Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915989548 1:160500056-160500078 TACCTTTGAGGAGGGAGAGGTGG + Intronic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
917574407 1:176305672-176305694 GCCATATGTGGAGTCAGTGGGGG + Intergenic
917629396 1:176877983-176878005 TCTTTGTGGGGAGGGAGTGGTGG - Intronic
917933256 1:179838979-179839001 ACCTTATGTGTTGGGAGTGGGGG - Intergenic
918078865 1:181190609-181190631 ACCCTATGAGGAGGGAGGGGAGG - Intergenic
918617746 1:186566293-186566315 TCACTGTTTGGAGTGAGTGGTGG + Intergenic
924064601 1:240208479-240208501 GTCCCAGGTGGAGGGAGTGGGGG - Exonic
924117974 1:240766493-240766515 TTCCCATTTGGAGAGAGTGGAGG + Intergenic
1062989253 10:1800160-1800182 TCCCATTGAGGAGGGAGTGAGGG + Intergenic
1063580032 10:7297921-7297943 TCCCACTGTGGAGGTGGTGGGGG - Intronic
1069755077 10:70769572-70769594 TCACTATGTGAAGGGATGGGGGG + Intergenic
1070482831 10:76902049-76902071 TCCTTATGTGATGGGAGTGAGGG + Intronic
1071580959 10:86769872-86769894 TCCCAGTGTGGATGGAGGGGTGG + Intronic
1072585092 10:96774505-96774527 GACGTGTGTGGAGGGAGTGGAGG + Intergenic
1073051638 10:100671059-100671081 CCCCAAAGTGGAGGGAGCGGGGG + Intergenic
1073205870 10:101769053-101769075 GCCGTATGTGGAGGGAGGGAGGG - Intergenic
1074078030 10:110147057-110147079 TACCTATGAGCTGGGAGTGGTGG + Intergenic
1075166612 10:120073639-120073661 TCCATATGTGGAGAGTTTGGGGG - Intergenic
1076542295 10:131221833-131221855 TCCCAACGTGGAGGCAGCGGCGG - Intronic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1077268303 11:1663136-1663158 TGCCTATGTGGGGAGAGTAGGGG + Intergenic
1077272576 11:1688483-1688505 TGCCTATGTGGGGAGAGTAGGGG - Intergenic
1077600310 11:3570099-3570121 TCCCTATTAGCAGGGACTGGGGG + Intergenic
1077648106 11:3944450-3944472 TGCCTGTGTAGTGGGAGTGGAGG + Intronic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1080691642 11:34563680-34563702 GCCCTGTACGGAGGGAGTGGGGG + Intergenic
1080964342 11:37196561-37196583 ACCCTTTGTGGAGGCAGTGAGGG - Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081815585 11:45938466-45938488 TAGCTATGTGGAGTGAGTAGGGG - Intronic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1084028762 11:66468351-66468373 GCCCTATGTGGGGGGAGGAGGGG - Intronic
1084962151 11:72722517-72722539 TCCTTATGCGGGTGGAGTGGTGG - Intronic
1085269282 11:75260724-75260746 TCCCTGGGGGGTGGGAGTGGGGG + Intergenic
1085309659 11:75508765-75508787 GCCCTATGTGGGGGGAGTAGGGG - Intronic
1085853689 11:80151691-80151713 ATCCAATCTGGAGGGAGTGGGGG - Intergenic
1085854270 11:80158367-80158389 TCCCTATTTGTTGGGAGTTGTGG - Intergenic
1086536007 11:87847613-87847635 TCCCTGTGTGGAGTGAGTAGGGG + Intergenic
1086691888 11:89796492-89796514 TCCCCAAGTGGTGGGATTGGAGG + Intergenic
1086713912 11:90043164-90043186 TCCCCAAGTGGTGGGATTGGAGG - Intergenic
1086845738 11:91747695-91747717 TTCCTCTGTGGAGGCTGTGGGGG + Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1091999186 12:5018787-5018809 TTCCTGTGGGGAGGGACTGGGGG + Intergenic
1092229852 12:6770296-6770318 TCCCTGTGTGGCAGGGGTGGGGG + Intronic
1092237371 12:6818768-6818790 CCCCTTGGTGGGGGGAGTGGGGG - Intronic
1093478476 12:19580900-19580922 TCCCAATGTGGTGGTACTGGAGG + Intronic
1095485837 12:42683692-42683714 TCTGCATGTGCAGGGAGTGGGGG - Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096487907 12:51996127-51996149 TCTCTTTGTGGAGGGGGTTGTGG - Intronic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098405580 12:70122983-70123005 TCCCTCTGTGGATGGGGTGCTGG - Intergenic
1099285355 12:80708930-80708952 CCCCTGCGTGGAGGAAGTGGTGG + Exonic
1100367582 12:93935799-93935821 TCACTGTGGGGATGGAGTGGAGG + Intergenic
1100807728 12:98304928-98304950 CCCCTCAGTGGAGGCAGTGGTGG - Intergenic
1101253503 12:102956710-102956732 TCTTTATGGGGAGGGGGTGGCGG + Intronic
1103276922 12:119719665-119719687 TACCTAGGAGGAAGGAGTGGAGG - Intronic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1103798162 12:123519522-123519544 TTCCTATGTGGGGGGTGAGGGGG - Intronic
1105345932 13:19572725-19572747 TCCATATCTGCAGGGATTGGGGG + Intergenic
1107010138 13:35662297-35662319 TGCTTCTGTGGAGGCAGTGGTGG + Intronic
1107234138 13:38148267-38148289 TACCTACATGGAGGAAGTGGTGG - Intergenic
1107333237 13:39324516-39324538 GCCCTGTGTGGACGGAGTGAGGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1108482842 13:50892290-50892312 TTCCTATGTGGCTGGAGGGGTGG - Intergenic
1109270018 13:60245510-60245532 TCCCTATGTGAAGGGAGTAGTGG + Intergenic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109514135 13:63419361-63419383 TCACTATGTGGGGGGAATTGAGG - Intergenic
1110596692 13:77327173-77327195 CCCCGAGGCGGAGGGAGTGGTGG - Intergenic
1111200660 13:84931971-84931993 TACCTATGTGGATTAAGTGGAGG + Intergenic
1111914451 13:94346462-94346484 TCCCAATGTGGTGGGATTAGAGG - Intronic
1112435507 13:99388893-99388915 TCCCTAAGAGGAGGGCCTGGGGG + Intergenic
1112836070 13:103515695-103515717 TCCACAGGTGGTGGGAGTGGGGG - Intergenic
1113233954 13:108248400-108248422 TTCCTCTGTGGAGGGAGGGAGGG + Intergenic
1113981721 13:114281891-114281913 GCCCTGAGTGGAGGGAGGGGAGG + Intronic
1114325347 14:21583295-21583317 TCCCAATGTGGAGGGATTACAGG + Intergenic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1117087658 14:52218423-52218445 TCCCAAAGTGCAGGGATTGGAGG - Intergenic
1119054255 14:71402946-71402968 TCCAAATGTGGAGGGAGAGGGGG - Intronic
1119150156 14:72351694-72351716 TGCCTTTGTGGAAGGGGTGGGGG + Intronic
1119383975 14:74245783-74245805 GCCTTAGGTGGATGGAGTGGTGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120789301 14:88564059-88564081 TCCCTAGGTGCTGGGAGTGCGGG + Intronic
1122269946 14:100564460-100564482 ACCCTGTTTGGAGGGAGAGGAGG + Intronic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123050279 14:105538070-105538092 TCCCTTTGAGGAGGGAGCCGCGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1123887596 15:24742207-24742229 TCAATTTGTGGAGGGAATGGAGG - Intergenic
1124705877 15:31963688-31963710 TCCCTTTGTGGTGTCAGTGGAGG - Intergenic
1124787276 15:32693345-32693367 TTCCTATGTGGAGGAAATTGAGG - Intronic
1125769620 15:42156439-42156461 GCCCTCTGTGGAGGCACTGGCGG - Exonic
1126700323 15:51360833-51360855 CCCCTGTGTGGAGGGAGGAGAGG + Intronic
1127447883 15:59084145-59084167 ATCCTATGTGGATGGGGTGGGGG - Exonic
1127627332 15:60793011-60793033 TCTCTCTTTTGAGGGAGTGGTGG - Intronic
1127999825 15:64180355-64180377 TGCCGAGGTGGAGGTAGTGGAGG - Exonic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129028274 15:72599425-72599447 TGTCTCTGTGGAGGGAGTAGAGG - Exonic
1129596925 15:76972834-76972856 TGCCTATGAGGAGGGAGCGAGGG - Intergenic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1130089514 15:80808353-80808375 TGCCTAAGTGGGGGCAGTGGGGG - Intronic
1132510564 16:339088-339110 TCCCTTTGGGCAGGGTGTGGTGG + Intronic
1132668114 16:1091053-1091075 CCCCTGTGGGGAGGGAGTGGGGG + Intronic
1132689975 16:1178010-1178032 TCCCCAGGGAGAGGGAGTGGGGG - Intronic
1134490757 16:14693937-14693959 TCCCTGGGAGGAGTGAGTGGGGG + Intronic
1134496138 16:14733055-14733077 TCCCTGGGAGGAGTGAGTGGGGG + Intronic
1135954549 16:26945342-26945364 ACCCTCTGTGGAAGGAGTAGAGG + Intergenic
1136154666 16:28374775-28374797 TCCCTGGGAGGAGTGAGTGGGGG - Intergenic
1136264514 16:29107159-29107181 TCCCTGGGAGGAGTGAGTGGGGG + Intergenic
1136791071 16:32968522-32968544 TCCCTTTGTGGGGGAGGTGGGGG - Intergenic
1137675368 16:50301300-50301322 CCCCCATGTGGAGGGAGAGGTGG + Intronic
1139215141 16:65120591-65120613 TCCCTAAGGGATGGGAGTGGGGG - Intronic
1140063974 16:71594318-71594340 CTCATTTGTGGAGGGAGTGGGGG - Intergenic
1141404596 16:83781139-83781161 TGCCTATGTGGAAGGACTTGTGG - Intronic
1141680068 16:85538650-85538672 CCCCTGTGGGGAGGAAGTGGAGG + Intergenic
1142934609 17:3317931-3317953 TCCCAGTGTGGAGAGAGCGGGGG - Intergenic
1143131269 17:4678994-4679016 TCCCTCTGTTGAGGGTGTTGAGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1147153343 17:38531098-38531120 TCCCTTTGTGGGGGAGGTGGGGG - Exonic
1147540724 17:41356540-41356562 TCCCTATGTAGAGGGAACTGGGG - Intergenic
1147853260 17:43458773-43458795 TCCCTTTCTGGAGAGAGTAGAGG - Intergenic
1148335478 17:46838047-46838069 CCCCTGTGTTGAGGGGGTGGAGG + Intronic
1149556997 17:57580445-57580467 GGCCTAAGTGGAGGGTGTGGGGG - Intronic
1149908191 17:60546065-60546087 TCCATGAGTGGAGGTAGTGGTGG - Intergenic
1150301786 17:64053269-64053291 CACCGATGTTGAGGGAGTGGAGG + Exonic
1150849260 17:68688878-68688900 TCCATCTGTGGAGGGAGGGAAGG - Intergenic
1151308437 17:73278957-73278979 CCCAAGTGTGGAGGGAGTGGGGG + Intergenic
1151436147 17:74099120-74099142 GGCCTGTGTGGAGGCAGTGGGGG - Intergenic
1151805568 17:76402898-76402920 TCCCAGTGAGGAGGAAGTGGTGG + Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152022289 17:77786519-77786541 TCCCTGTGTGAAGGGAGATGTGG - Intergenic
1152928477 17:83098644-83098666 TCCTCATGTGGAGGGAGTCGAGG - Intergenic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155746446 18:29361306-29361328 TCCCTTAGAGGAGGGACTGGCGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1156497610 18:37536419-37536441 TCCCTTTTAGGAGGGAGTGGGGG - Intronic
1157003498 18:43554629-43554651 TTTCTATGTGGAGGCAGGGGTGG + Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1159899036 18:74025114-74025136 TCCCTGTGAGGAGGGAGGGGAGG - Intergenic
1160786263 19:901384-901406 TCCCCGTGTGGAGGGAGTGAGGG + Intronic
1160967450 19:1752971-1752993 CCTCTTTGTGGAGGAAGTGGGGG - Exonic
1161545946 19:4879980-4880002 TCCTGATATGGAGGGGGTGGGGG + Intergenic
1162938031 19:13991486-13991508 TTACTATATGGACGGAGTGGAGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163503910 19:17692824-17692846 GGCCTATGTGGAGGGAGGGAAGG + Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164540032 19:29115327-29115349 TTCATAAGAGGAGGGAGTGGGGG + Intergenic
1165140914 19:33699341-33699363 TCCCAATCTGGGGGCAGTGGAGG + Intronic
1165340679 19:35209625-35209647 TGCCTTTGGGGATGGAGTGGAGG + Intergenic
1165382718 19:35492470-35492492 ACCCTATGCGGATGGAATGGTGG - Intronic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1165705231 19:37971237-37971259 TCCCTAAGTGCTGGGAGTGCAGG + Intronic
1165803516 19:38566904-38566926 TCCCTAGGTGGATGGAGTGGAGG + Exonic
1167349009 19:48963468-48963490 CCCATAGGTGGAGGGAGAGGAGG - Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1168142880 19:54401017-54401039 TTCCTCTGTGGAGGGAAAGGTGG - Intergenic
1168277223 19:55284727-55284749 TCCCTGGATGGAGGGGGTGGGGG + Intronic
925333391 2:3075797-3075819 TCCAAATCTGTAGGGAGTGGGGG - Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
932003669 2:67907025-67907047 GCCCTGGGTGGGGGGAGTGGAGG + Intergenic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
933970832 2:87468649-87468671 TCCCTAGGTGGATGGATGGGTGG + Intergenic
935262259 2:101365407-101365429 TCCCTAGGAGGATGGAGTAGAGG - Intronic
935685867 2:105682042-105682064 ACCCTCTGCGGAGAGAGTGGAGG + Intergenic
936615970 2:114048154-114048176 TCCCTATGTGCAGGGAGGAGGGG - Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
940229029 2:151430669-151430691 ACCCTAAGTGGGGGGAGGGGGGG - Intronic
940276695 2:151947433-151947455 TCCCTAGGCAGGGGGAGTGGGGG + Intronic
941622501 2:167793890-167793912 TCCCTATGCGGAGGGCATGAAGG - Intergenic
943117468 2:183691515-183691537 TCCCTGTGTGCTGGCAGTGGTGG - Intergenic
944540290 2:200747765-200747787 TCATTATGTGGAGGGAGGAGGGG + Intergenic
947151844 2:227123585-227123607 GCCCTAGGGGAAGGGAGTGGGGG + Intronic
947153876 2:227141107-227141129 TGCCAGTGGGGAGGGAGTGGTGG + Intronic
947361311 2:229348237-229348259 TACCCATGTGAAGGGAGGGGAGG - Intergenic
947698630 2:232214263-232214285 TCCATAAGTGGATGCAGTGGAGG - Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1170775507 20:19371593-19371615 TCCCTGTATGTAGGGGGTGGTGG - Intronic
1170792004 20:19516244-19516266 TCCCCATTTGGAGGGTTTGGGGG + Intronic
1172560359 20:35882672-35882694 TCCCAAAGTGGTGGGATTGGAGG + Intronic
1172774663 20:37400056-37400078 TCCCTGTGTGGTAGGAGTTGGGG + Intronic
1172793733 20:37523211-37523233 TGCCTGTGTGGCGGGACTGGAGG + Exonic
1173249507 20:41357241-41357263 TCCCTCTGTGCTGGGTGTGGTGG + Intronic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1173987655 20:47274971-47274993 TTCCTGTGTGAAGGGAGTGAGGG + Intronic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1175790892 20:61739217-61739239 TTCCCATGGGGAGGGAGTTGCGG + Intronic
1175811091 20:61857553-61857575 CCCCCATGTGGAGGGAGCTGGGG + Intronic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1178287164 21:31335299-31335321 TCACTTTGTGGAGGGTGGGGAGG - Intronic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1178702279 21:34843948-34843970 GCCCTCTGTGGGGGAAGTGGAGG + Intronic
1179038655 21:37782565-37782587 CCCCTGGGTGGAGGGAGTTGTGG - Intronic
1179879143 21:44286251-44286273 TCCTTGTGGGGAGGGAGTTGGGG - Intronic
1180687882 22:17684552-17684574 TCACTATGTGGTGGTGGTGGTGG + Intronic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181941562 22:26481736-26481758 TGCCTCTGTGGAGGTAGAGGTGG + Exonic
1183036443 22:35144261-35144283 CCCCGCTGTGGAGGGGGTGGGGG + Intergenic
1183293197 22:37015321-37015343 TCCCTTCTTGGAGGGAGTGAGGG - Intronic
1184259154 22:43304812-43304834 GCCCTACCTGGAGTGAGTGGAGG - Intronic
1184804969 22:46788889-46788911 TTCCTCTGTGGAGTGAGGGGTGG + Intronic
1185187641 22:49412170-49412192 TCTTCACGTGGAGGGAGTGGAGG + Intergenic
950558644 3:13709574-13709596 TGGTTATGTGGAGGGAATGGAGG + Intergenic
950652691 3:14417072-14417094 TCCCAAAGTGCAGGGATTGGAGG - Intronic
951171225 3:19543987-19544009 TCCCAGTGTGGAGGCATTGGAGG - Intergenic
952945633 3:38476571-38476593 TCCGTATGGGCAGGGAGTTGTGG + Intronic
953383617 3:42492458-42492480 TTCCTCTGTGGAGGGAGGAGAGG - Intronic
953980353 3:47410336-47410358 TCCCTATGTGGGGGTAGGGCCGG + Exonic
954092725 3:48298003-48298025 TCCTTATCTGGAGGGTCTGGGGG - Intronic
954713022 3:52514268-52514290 TCCCTTCGTGGTGGGATTGGAGG - Intronic
955133824 3:56196277-56196299 TCTCTGTGAGGAGGGAGTGTGGG - Intronic
956535756 3:70274165-70274187 TACATATGTGTAGGGGGTGGGGG + Intergenic
956629718 3:71304219-71304241 GGCCGATGTGGAGTGAGTGGGGG - Intronic
958709604 3:97701301-97701323 TCCCTGTGTGGAGATAGTAGGGG + Intronic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
960049457 3:113226131-113226153 TCCTAATGTGGGGGGAATGGGGG + Intronic
961317765 3:126052264-126052286 ACCCTATGTGGAGGGTGTGCAGG - Intronic
962531305 3:136283390-136283412 GCCTTCTGTGGAGGGTGTGGAGG + Intronic
962588036 3:136862044-136862066 GCCTGATGTGGAGGGAGCGGAGG - Intergenic
964691648 3:159456301-159456323 TCTCTATGTTGAGGGAATGATGG + Intronic
964753560 3:160074620-160074642 TCCCTGTGTGGAAGGAATGTGGG - Intergenic
964945238 3:162214627-162214649 TCCACATGTGGAGTGAGTGGAGG - Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966559002 3:181297858-181297880 TGCCTGTGTGGAGGGAGGGCAGG - Intergenic
967156199 3:186694810-186694832 CCCACATGGGGAGGGAGTGGAGG + Intergenic
967228292 3:187314003-187314025 TCCCTATGAAGAAGGGGTGGAGG + Intergenic
967305393 3:188054008-188054030 TCCCTATGTGGACGGAGAACAGG - Intergenic
968227163 3:196979966-196979988 TCCGTATGTGGAGGAACTTGGGG + Intergenic
968761681 4:2445461-2445483 TCCCTCTCTGTGGGGAGTGGGGG - Intronic
968942367 4:3645407-3645429 TCTCTATGTGCGGGGAGAGGCGG - Intergenic
969723973 4:8908331-8908353 TCCCTGGGTGGAGGGACTGGCGG - Intergenic
971036035 4:22693740-22693762 TCCCTTTGTGGAGGGGAAGGGGG - Intergenic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972390090 4:38606098-38606120 TCCCTCTGTGGAGGGTGGAGTGG - Intergenic
972597497 4:40542793-40542815 TCCCTATGTGCTGGGATTGCAGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
980035005 4:127873119-127873141 TCCCTCTCTGGTGGTAGTGGAGG - Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
983081235 4:163387597-163387619 ACCCTATGTGGAGGGTGTCAGGG + Intergenic
983590570 4:169406180-169406202 TCCCAATGTGGTGGGATTGTAGG + Intronic
984614482 4:181881109-181881131 TCCTTAAATGGAGAGAGTGGTGG - Intergenic
986735027 5:10662141-10662163 TTCCTATGGAGACGGAGTGGGGG - Intergenic
990837248 5:60035688-60035710 TCCCTATTTGGGAGGAGGGGTGG - Intronic
992024180 5:72654329-72654351 TCCCTCTGTGGGGAGAGAGGAGG - Intergenic
992793468 5:80234513-80234535 GCCCTTTGTGGTGGGAGTGGTGG - Intronic
994188319 5:96839670-96839692 TCCCTCTGAGCAGGGAGTGAAGG - Intronic
997640349 5:135444918-135444940 TTCCTGTGTGGATGGAGTGTTGG + Exonic
997800962 5:136861635-136861657 TCCCTGGGTGGTGGGAGTGAGGG + Intergenic
998002398 5:138635392-138635414 GCCCTGTGAGGAGGGAGTTGGGG - Intronic
998382208 5:141733786-141733808 TCCCTAGGAGGTGGGAATGGGGG + Intergenic
998770319 5:145536551-145536573 TTCCTATGTGGAGGGAAAGCTGG + Intronic
999317997 5:150596532-150596554 TCCAGATGTGGAGGGCGGGGTGG - Intergenic
1000645336 5:163754637-163754659 TCAGTTTGTGGAGGGAGTGTAGG - Intergenic
1001594017 5:172886210-172886232 GCCCGATGTGCAGGGAGAGGAGG - Intronic
1001631964 5:173182139-173182161 TCCCCATGTGGACTGAGTTGGGG - Intergenic
1001932398 5:175682716-175682738 TCCCTCTCTGGAGTCAGTGGAGG - Exonic
1002195831 5:177500789-177500811 TCCATGTGTGGAGGGAGATGGGG + Intergenic
1002766287 6:241674-241696 AGGCTATTTGGAGGGAGTGGCGG - Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007040240 6:38715225-38715247 TCCCTACGGGGAGCGACTGGAGG - Intergenic
1007220578 6:40275734-40275756 GCCTTAGGAGGAGGGAGTGGAGG - Intergenic
1007905247 6:45453351-45453373 TACCTATGTGGGGACAGTGGAGG + Intronic
1009378732 6:63004107-63004129 TGCCTTTGTGAAGGGAATGGTGG + Intergenic
1009564643 6:65297777-65297799 TCTGTATGTGGAGGGAGAAGAGG - Intronic
1011297694 6:85841220-85841242 TCCCTGTGGGGTGGGGGTGGGGG + Intergenic
1012820296 6:104078416-104078438 TCCCTATGTGCTGGGAGTACAGG + Intergenic
1013212923 6:108002808-108002830 TCCCTATGGGGAAGGAGGGAGGG - Intergenic
1014273865 6:119365104-119365126 TAACTATGTGGAGGGAGTAGGGG - Intergenic
1015327591 6:131941078-131941100 TCCAGATGTGGAGCGGGTGGTGG + Intergenic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1017499155 6:155007150-155007172 TCAGTGTGTGGAGGGTGTGGGGG + Intronic
1017802021 6:157905536-157905558 TGGCTATGGGGAGGGGGTGGGGG - Intronic
1017818414 6:158031441-158031463 TCCCTTTCTGAAGGGAGAGGAGG + Intronic
1018096993 6:160397125-160397147 TCCATGGATGGAGGGAGTGGGGG + Intronic
1018411455 6:163552946-163552968 ACCCACTGTGGCGGGAGTGGTGG - Intronic
1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG + Intergenic
1019340407 7:506404-506426 TCTCTAGGTGGGCGGAGTGGAGG - Intronic
1019487889 7:1297571-1297593 TGCCTTTGTGCAGGGGGTGGGGG + Intergenic
1019850702 7:3553828-3553850 TCCCTCAGTAGAAGGAGTGGTGG - Intronic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1023503042 7:40871351-40871373 TAGCTATGTGGAGAGAGAGGGGG + Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1024582636 7:50812462-50812484 TCCCTACGGAGATGGAGTGGGGG + Intergenic
1025900386 7:65739598-65739620 GCCCTATGTGCAGTGATTGGTGG + Intergenic
1032453201 7:132052307-132052329 TTTCTTTGGGGAGGGAGTGGGGG + Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034165639 7:149023065-149023087 TCCTGGTGTGGAGGGAGGGGTGG - Intronic
1034981771 7:155483705-155483727 CCTCTATGAGGAGGCAGTGGAGG - Intronic
1035731266 8:1854982-1855004 GGCGTATGGGGAGGGAGTGGAGG + Intronic
1037881651 8:22576387-22576409 TCCCTGTGGGGTGGCAGTGGTGG + Intergenic
1037995782 8:23351389-23351411 TTGCTATCTGGAGGAAGTGGGGG - Intronic
1038244582 8:25843466-25843488 ACCCAAAGCGGAGGGAGTGGTGG + Exonic
1039401639 8:37274907-37274929 TGCCTGTGTGGAGGGTGGGGTGG - Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1039637784 8:39184634-39184656 TCCCTCTGTGGAAGGCTTGGGGG + Intronic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044729467 8:95218542-95218564 TCCCTCTTTGGTGGGTGTGGTGG + Intergenic
1045370182 8:101515076-101515098 TCCCTATAAGGAGGGAGGGAGGG - Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1048326527 8:133443402-133443424 TCACTATGTGGTGGCGGTGGAGG - Intergenic
1051017776 9:12501635-12501657 ACAGTATGTGGTGGGAGTGGTGG + Intergenic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055320942 9:75083009-75083031 TTTCTGTGTGGATGGAGTGGGGG - Intronic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1057280843 9:93710414-93710436 TCCCAGTGTGCAGCGAGTGGGGG + Intergenic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1061840041 9:133353379-133353401 GCCCTACCTTGAGGGAGTGGAGG - Intronic
1061929231 9:133823971-133823993 TCCCTCAGTGGTGGGGGTGGGGG + Intronic
1062277293 9:135736975-135736997 CCCCTACGTGGGGGGAGTGGGGG - Intronic
1062282522 9:135758396-135758418 TCATTCTGTGGAAGGAGTGGTGG - Exonic
1062445199 9:136590795-136590817 TCCCTCTGGGGATGCAGTGGGGG - Intergenic
1062570342 9:137182090-137182112 TCCCTATGTGCTGGGATTGCAGG - Intronic
1185653479 X:1666123-1666145 TCCCTAAGTGGTGGGATTAGAGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186902886 X:14076917-14076939 TAGATATGGGGAGGGAGTGGGGG - Intergenic
1188734443 X:33695321-33695343 TCCCTCTGTGATGGTAGTGGAGG - Intergenic
1189280221 X:39815996-39816018 TCCCTCAGTCCAGGGAGTGGTGG - Intergenic
1189852993 X:45195383-45195405 ACCCTATGTTGAGGGACTTGGGG - Intronic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193809109 X:86030676-86030698 TCCCTCTGTAGAGGGAGTCATGG + Intronic
1194647496 X:96475293-96475315 TACAAGTGTGGAGGGAGTGGTGG - Intergenic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1197719892 X:129738222-129738244 CCCCTATCTGGAGGGTTTGGGGG - Intergenic
1199745642 X:150770617-150770639 GCCCTATGAGGATGGAGTGCCGG - Intronic
1200082762 X:153587172-153587194 TGCTTATGTGGAGGGAGAGATGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201147566 Y:11073206-11073228 TCTCCATGTTGAGGGCGTGGCGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic