ID: 1129982087

View in Genome Browser
Species Human (GRCh38)
Location 15:79882450-79882472
Sequence CTGTTACAGCACTCGGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129982082_1129982087 -6 Left 1129982082 15:79882433-79882455 CCACATTGACCCAGCAGCTGTTA 0: 1
1: 0
2: 0
3: 6
4: 159
Right 1129982087 15:79882450-79882472 CTGTTACAGCACTCGGGCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 70
1129982080_1129982087 16 Left 1129982080 15:79882411-79882433 CCCAGAGACTGGATTGAGAATAC 0: 1
1: 0
2: 3
3: 10
4: 149
Right 1129982087 15:79882450-79882472 CTGTTACAGCACTCGGGCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 70
1129982081_1129982087 15 Left 1129982081 15:79882412-79882434 CCAGAGACTGGATTGAGAATACC 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1129982087 15:79882450-79882472 CTGTTACAGCACTCGGGCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129982087 Original CRISPR CTGTTACAGCACTCGGGCTC AGG Intronic
900205642 1:1430998-1431020 CTGCCCCGGCACTCGGGCTCTGG - Intergenic
900972249 1:5998162-5998184 CTGTGACCGCACTGGGCCTCTGG - Intronic
907456816 1:54581512-54581534 CTGTGACATGACTCTGGCTCAGG + Intronic
913153882 1:116074950-116074972 CTGTCACATCACTTGAGCTCAGG - Intergenic
915846940 1:159276646-159276668 CTTCTACAGCACTCGGTCCCAGG + Intergenic
918950172 1:191126284-191126306 CTGCTACAGCCCTTGGGCTTTGG - Intergenic
920534614 1:206729494-206729516 CCCCCACAGCACTCGGGCTCAGG - Intronic
921094562 1:211875184-211875206 CTGCTGCAGCACACTGGCTCTGG - Intergenic
924214811 1:241809960-241809982 CTGTTCAAGCACTCAGGGTCTGG - Intergenic
1064148238 10:12842202-12842224 CTTTTGCATCACTCGGGCTGGGG - Intergenic
1071848230 10:89541542-89541564 GTGTTACAGCACTCCAGCTTGGG + Intronic
1074227709 10:111503622-111503644 CTGTTACATCACTCAGGGTCAGG + Intergenic
1074330879 10:112507765-112507787 CTATTACCTCACTCTGGCTCAGG + Intronic
1088760644 11:112926054-112926076 CTGTCTTAGCACTCAGGCTCAGG + Intergenic
1091937276 12:4443885-4443907 CCGTTTAAGCACACGGGCTCCGG + Intronic
1095295001 12:40517580-40517602 CTGTCACAGCACTATGTCTCTGG + Intronic
1104873904 12:132019708-132019730 CTATTACAGCACAAGGGCTGAGG - Intronic
1107946319 13:45420188-45420210 CTGTTACAGAACCAGGGCCCAGG + Intergenic
1110238982 13:73245899-73245921 CTGCTACTGCACATGGGCTCTGG + Intergenic
1110343651 13:74420782-74420804 CTATGACAGCAATGGGGCTCAGG - Intergenic
1110827615 13:79990908-79990930 CTATTACAGTACTCGGGGTTAGG - Intergenic
1117013023 14:51490112-51490134 CTTTTACAACACTTGGGATCTGG - Intronic
1118698543 14:68410232-68410254 CTGTTGCAGCATTTGGGCCCAGG + Intronic
1121436465 14:93923775-93923797 GCTTTACAGAACTCGGGCTCTGG + Intronic
1129982087 15:79882450-79882472 CTGTTACAGCACTCGGGCTCAGG + Intronic
1131590925 15:93747264-93747286 CTGTTCCAGCCTTCTGGCTCTGG + Intergenic
1132099726 15:99014923-99014945 CTGTTGCAGCGCGCGGGCCCGGG - Intergenic
1132607972 16:801359-801381 CAGCTGCAGCACTTGGGCTCGGG + Intergenic
1138599336 16:58045784-58045806 CAGTTACAGCCCTGGGGTTCAGG - Exonic
1139274633 16:65716190-65716212 CTGATACAGAACTCAGGCTTGGG - Intergenic
1140117070 16:72051158-72051180 CTTTTACAGCACCCGGAATCTGG - Intronic
1146037421 17:29419920-29419942 CTGTCACTGCACTCGAGCTTGGG - Intronic
1146162168 17:30565919-30565941 CTGTGACAGCTCCCGGGATCTGG + Intergenic
1147427285 17:40351948-40351970 CTCTCAGAGCACTCGGGCTTGGG - Exonic
1151315407 17:73318906-73318928 CTGATAAAGGACTCAGGCTCTGG + Intergenic
1152411879 17:80129659-80129681 TTTTTAAAGCACCCGGGCTCAGG - Intergenic
1160778683 19:868306-868328 CTCTTGCAGCAGCCGGGCTCAGG + Intronic
1160805293 19:989924-989946 CTGGAACTGCACCCGGGCTCAGG + Intronic
1160999796 19:1904986-1905008 CTGTTACTGCACTCCGGCGTGGG - Intergenic
1161381238 19:3966196-3966218 CTGTTAGAGCACCTGGGCTCTGG - Intronic
1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG + Intergenic
931268631 2:60682742-60682764 CTGATACAGAACTCAGGCCCAGG + Intergenic
934624599 2:95835854-95835876 TCGTTACAGCCCGCGGGCTCTGG + Intergenic
934765015 2:96875760-96875782 CAGTTACAGCACTGGGGCCCAGG - Intergenic
934808982 2:97265566-97265588 TCGTTACAGCCCGCGGGCTCTGG - Intergenic
934828523 2:97491603-97491625 TCGTTACAGCCCGCGGGCTCTGG + Intergenic
935181081 2:100691842-100691864 ATGGTCCAGCACTTGGGCTCTGG - Intergenic
935695017 2:105763613-105763635 CTGTTACAGCAGTGGGGTTGGGG + Intronic
938645553 2:133326533-133326555 CTGTTACAGGACTCTTGCTGTGG - Intronic
946047828 2:216836043-216836065 TTGTTAGACCACTGGGGCTCTGG + Intergenic
948295977 2:236860992-236861014 TAGATACAGCACTGGGGCTCAGG + Intergenic
1168883433 20:1226165-1226187 CGCCTACAGCACTCGGGGTCCGG - Exonic
1172673028 20:36647415-36647437 CAGCTACAGCACTCCTGCTCAGG + Intergenic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1180112763 21:45671632-45671654 CTGTTACAGGATTTGGGCTTTGG + Intronic
1185021578 22:48379780-48379802 CTGCTCCAGCTCTGGGGCTCTGG - Intergenic
1185181296 22:49364841-49364863 CTGTTACATCACTCGGTCAAAGG + Intergenic
955982990 3:64545931-64545953 CTGTCACAGCCCCCTGGCTCTGG - Intronic
968054912 3:195684013-195684035 CTCTGACAGCAGTCGGGCTTCGG + Intergenic
971645972 4:29203800-29203822 CTGTTGCATAACACGGGCTCTGG - Intergenic
972646856 4:40976686-40976708 CAGACACAGCACTGGGGCTCAGG + Intronic
993112287 5:83672873-83672895 CTGCTACAGCTCTCAGGCTTAGG + Intronic
995694874 5:114867316-114867338 CTGTTACAGCCTTCTGGCTTTGG + Intergenic
999200018 5:149809643-149809665 ATGTTACTGCACTCCAGCTCGGG + Intronic
1002300820 5:178256492-178256514 GGGTTCCAGCACTCGGGCCCTGG - Intronic
1005212435 6:23482202-23482224 GTGTTTCAGCATACGGGCTCTGG + Intergenic
1006239464 6:32664893-32664915 CTGTTCCAGTACTCGGCATCAGG + Exonic
1011887028 6:92109356-92109378 CTGTTACAACACACTGGCTCGGG - Intergenic
1018817310 6:167343197-167343219 CTGACACAGCCCTGGGGCTCGGG - Intronic
1020512601 7:9077047-9077069 CTGTTGCAGTACTTGGGTTCTGG - Intergenic
1022319818 7:29278048-29278070 GTGGTTCAGCACTTGGGCTCTGG - Intronic
1033988292 7:147253180-147253202 CTGTTACGGTCCTCGGTCTCTGG + Intronic
1037860281 8:22399958-22399980 CTGTCACAGTGCTCGTGCTCTGG - Intronic
1046158087 8:110320314-110320336 CTGTTACATCCCTTGGTCTCGGG + Intergenic
1061606190 9:131712620-131712642 CAGTTACAGAACCTGGGCTCAGG + Intronic
1196241428 X:113346807-113346829 CTGTTCCAGCCTTCGGGCTTTGG - Intergenic
1197904643 X:131412172-131412194 CTCTAACAGCACTCGGGCTGGGG + Intergenic