ID: 1129982776

View in Genome Browser
Species Human (GRCh38)
Location 15:79889526-79889548
Sequence TGGGTCCCAAACTAAAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129982776_1129982780 8 Left 1129982776 15:79889526-79889548 CCTGACTTTTAGTTTGGGACCCA 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1129982780 15:79889557-79889579 CTGCTCCTTTTATCCCTTCCTGG 0: 1
1: 0
2: 5
3: 24
4: 234
1129982776_1129982784 22 Left 1129982776 15:79889526-79889548 CCTGACTTTTAGTTTGGGACCCA 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1129982784 15:79889571-79889593 CCTTCCTGGTACACCCACTCTGG 0: 1
1: 0
2: 1
3: 9
4: 143
1129982776_1129982786 26 Left 1129982776 15:79889526-79889548 CCTGACTTTTAGTTTGGGACCCA 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1129982786 15:79889575-79889597 CCTGGTACACCCACTCTGGTAGG 0: 1
1: 0
2: 1
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129982776 Original CRISPR TGGGTCCCAAACTAAAAGTC AGG (reversed) Intronic
900494674 1:2971080-2971102 TGGCTCCCAAGCCAAAAGCCTGG - Intergenic
902218139 1:14947537-14947559 TGCTTCGCAAACTAAATGTCAGG - Intronic
911426459 1:97720339-97720361 TGGGTCCCCAAAGAAAAGTGAGG + Intronic
911911046 1:103635656-103635678 TGGAACCCAAACAAAAATTCTGG - Intergenic
911918461 1:103729798-103729820 TGGAACCCAAACAAAAATTCTGG - Intronic
911921568 1:103768888-103768910 TAGAACCCAAACTAAAATTCTGG - Intergenic
920822927 1:209398233-209398255 TGAGTCCCTAACAGAAAGTCAGG + Intergenic
1063858862 10:10286855-10286877 TGGATACAAAAGTAAAAGTCAGG + Intergenic
1068782906 10:60941296-60941318 TGAGTCCCAAACTATAGGTGAGG - Intronic
1069900777 10:71705503-71705525 TGTCTCCCAAACAAAAACTCTGG - Intronic
1072823138 10:98578311-98578333 TGGGTCCCCATCCAAAAGACTGG - Intronic
1073203302 10:101753602-101753624 TGGGTCCCAAACTGTATGGCAGG - Intergenic
1077800462 11:5531042-5531064 TGAGTCCCGAACAAAGAGTCTGG + Intronic
1080930845 11:36808553-36808575 TGGATCTTAAATTAAAAGTCTGG - Intergenic
1081745217 11:45468151-45468173 TGGGTCCCTAACTAAGTGTGGGG + Intergenic
1083078981 11:60071636-60071658 TGAGCCCCAAACAAAGAGTCCGG + Intergenic
1083193760 11:61070732-61070754 TGAGCCCCAAACAAAGAGTCCGG + Intergenic
1085014622 11:73165143-73165165 TGGGGCCCAAACTGGAAGACAGG + Intergenic
1086426412 11:86688311-86688333 TGGGTCCCCAACTGAGAGTCTGG + Intergenic
1089603939 11:119630812-119630834 TGGGTCCCAACCCACAAGTTGGG + Intronic
1094593894 12:31846692-31846714 TGGGTCCCAGAATAAGACTCAGG + Intergenic
1094821794 12:34231857-34231879 TGAGACCCAAACTAAGGGTCAGG + Intergenic
1104601397 12:130156291-130156313 GGGGTCCCATTCTGAAAGTCAGG + Intergenic
1108095084 13:46893161-46893183 TGGGTGCCAAACTCAAATTTGGG + Intronic
1111948387 13:94689719-94689741 TGTGGCCCAAACTTCAAGTCTGG + Intergenic
1112732818 13:102385774-102385796 TTTGTCCCAAGCTAAATGTCTGG + Intronic
1114580191 14:23750279-23750301 TGGGTCCCATTGTAAGAGTCAGG + Intergenic
1116790383 14:49334219-49334241 TGGCTCCCAAAATAAAAGAGAGG + Intergenic
1117436916 14:55724336-55724358 TGGGTCCCAAAATGAAAACCAGG - Intergenic
1120900262 14:89569289-89569311 TGGGTGCCCATCTAAGAGTCAGG + Intronic
1123074117 14:105658053-105658075 TGGGTCCCAAATCCAAAGACTGG - Intergenic
1126963349 15:54023697-54023719 TGGCTCCCAAACTATAAGACTGG + Intronic
1127341355 15:58048078-58048100 TGAGTCCTAAGCTGAAAGTCAGG + Intronic
1129982776 15:79889526-79889548 TGGGTCCCAAACTAAAAGTCAGG - Intronic
1130867257 15:87943513-87943535 TGGGTCCCTAAGTACAACTCTGG + Intronic
1133205177 16:4228887-4228909 GGGGTCCCAAACCCAGAGTCTGG - Intronic
1133623490 16:7548846-7548868 TGGGTCCCTAACTAATAGGCAGG - Intronic
1136501292 16:30670686-30670708 TGGGGCCCAACCTAGAAGGCAGG + Exonic
1141385041 16:83614322-83614344 TGGGGTCCTAACTGAAAGTCTGG + Intronic
1145775828 17:27527690-27527712 TGTGCCCCAAACAAGAAGTCAGG - Intronic
1147601043 17:41745686-41745708 TGTCTCACAAAATAAAAGTCGGG + Intergenic
1155182163 18:23357390-23357412 TTGGTCACAAACAAGAAGTCAGG + Intronic
1155736033 18:29223891-29223913 TGAGTCCCAAATTACATGTCAGG - Intergenic
1164160298 19:22621827-22621849 TGAGCCCCAAACAAAGAGTCAGG + Intergenic
1164458944 19:28431418-28431440 TGACTCTCAAAGTAAAAGTCAGG - Intergenic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
926781615 2:16477867-16477889 TGGATATCAAAATAAAAGTCAGG + Intergenic
928110376 2:28503631-28503653 TGGGTCCCAAATGAGATGTCTGG + Intronic
929904949 2:46037308-46037330 AGGATCCCAAACTCCAAGTCAGG + Intronic
930462596 2:51702261-51702283 TGGGTCCTGAACTAAAACTAGGG - Intergenic
931428682 2:62193303-62193325 TGGGTCCCAACCTAACAGTAGGG + Intergenic
937502124 2:122490592-122490614 GGGGTCCAAACCTAAAAGACAGG - Intergenic
939016139 2:136905556-136905578 TTGGTCCTAAATTAACAGTCAGG + Intronic
948356125 2:237378798-237378820 TAGCTCCCACACAAAAAGTCAGG + Exonic
1169318984 20:4615672-4615694 TGCATCACAAACTCAAAGTCAGG - Intergenic
1173220117 20:41125588-41125610 TTGGTCCAAAACTAGAAGTCAGG + Intergenic
1174622709 20:51888426-51888448 TGGGTCTGAAAGTAAAAGACTGG + Intergenic
1177219033 21:18166824-18166846 TGGTCCCCAAACTAAAAGACAGG - Intronic
1177315278 21:19452459-19452481 TGAGTTGCAAACTAAAAGTCTGG - Intergenic
1178811926 21:35892320-35892342 TGGGCCCCAATCTAAACCTCAGG + Intronic
1182751921 22:32648511-32648533 TGGGGCCAAAACTTTAAGTCCGG - Intronic
1184786997 22:46676758-46676780 TGCTGCCCAAACTAAAACTCTGG - Intronic
961680889 3:128599218-128599240 TGAGGCCCAAACTGAAAGTAGGG - Intergenic
962330512 3:134473787-134473809 TGTGTCCCCAACTTATAGTCAGG - Intergenic
964517950 3:157533179-157533201 AGGGTCCAAAACACAAAGTCTGG + Intronic
967398467 3:189033189-189033211 TTTGTACCAAACTAAAAGCCAGG + Intronic
970247697 4:14080576-14080598 TGGGGCCCAAAATAGAGGTCAGG - Intergenic
978465789 4:109007443-109007465 TGTGTCCCCAAGGAAAAGTCTGG - Intronic
991584034 5:68184659-68184681 TGGGTCCTAAAATAAATGTCAGG + Intergenic
995867116 5:116703051-116703073 TAGCTTCCAAACTCAAAGTCTGG - Intergenic
997235317 5:132269126-132269148 TGGGACTCAAACTAAAACTGAGG + Intronic
997882695 5:137604505-137604527 TGGGTTCTAAACCAAAAATCAGG + Intergenic
1003937330 6:10988918-10988940 TGGTTCCCAAACAAACAGTGAGG + Intronic
1010126520 6:72438737-72438759 TGGATGGAAAACTAAAAGTCTGG + Intergenic
1017080639 6:150665138-150665160 TGGGTTCCAGACTTGAAGTCTGG + Intronic
1020914150 7:14170971-14170993 TGGGTCACACAGTAGAAGTCTGG + Intronic
1021325558 7:19262694-19262716 TGGATCACAAACGAAAATTCAGG - Intergenic
1031252609 7:119407022-119407044 TAGATCCAAAACTAGAAGTCAGG - Intergenic
1031276368 7:119728805-119728827 TGATTCCCAAAATAAAATTCTGG + Intergenic
1038142582 8:24862817-24862839 TGGATCACAAACTCAAACTCAGG + Intergenic
1039381829 8:37092799-37092821 TGGGTCCCAACCTTCCAGTCAGG + Intergenic
1039745167 8:40418940-40418962 TGGGACTCAAATTAGAAGTCAGG + Intergenic
1040098756 8:43477517-43477539 TGAGCCCCAAACAAAGAGTCCGG + Intergenic
1040690833 8:49936664-49936686 TGGGTACAAAAAGAAAAGTCAGG - Intronic
1051414766 9:16827609-16827631 TGGGTCTCAACCTAAAAATGGGG + Intronic
1052188856 9:25632894-25632916 TGGGTCCCCAAGGAAAACTCTGG + Intergenic
1053274342 9:36771869-36771891 TGGGTCCCACACTTGAGGTCAGG + Intergenic
1186720687 X:12300442-12300464 GGGGTCTGAAAATAAAAGTCAGG + Intronic
1190629339 X:52369419-52369441 TGGGTCCCTACCAAGAAGTCTGG - Intronic
1193983840 X:88216410-88216432 TTGGTCTCAAACTAAAACACTGG + Intergenic
1194490576 X:94542857-94542879 TGGGTTCAAAAATAAAACTCTGG - Intergenic
1196247032 X:113412491-113412513 TGGGTACTAAACTGAATGTCAGG + Intergenic
1196540573 X:116902042-116902064 TGTGTTACAAATTAAAAGTCAGG - Intergenic
1197039116 X:121913860-121913882 AGGGTCCCACACTAGAAGGCAGG + Intergenic
1198377687 X:136055311-136055333 AGGGCCCCAAACAAAAAGGCTGG + Intergenic
1199572385 X:149280073-149280095 TGGATCCCAAATGAAAATTCAGG - Intergenic