ID: 1129983366

View in Genome Browser
Species Human (GRCh38)
Location 15:79895075-79895097
Sequence ATGGATAATATCACTCTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129983366_1129983369 -1 Left 1129983366 15:79895075-79895097 CCTACAAGAGTGATATTATCCAT 0: 1
1: 0
2: 3
3: 12
4: 135
Right 1129983369 15:79895097-79895119 TTTTATAGACAAGGAACCAAAGG 0: 1
1: 2
2: 19
3: 237
4: 1308
1129983366_1129983371 28 Left 1129983366 15:79895075-79895097 CCTACAAGAGTGATATTATCCAT 0: 1
1: 0
2: 3
3: 12
4: 135
Right 1129983371 15:79895126-79895148 GAGATTATGAGACCTGTCCAAGG 0: 1
1: 0
2: 4
3: 57
4: 511
1129983366_1129983367 -10 Left 1129983366 15:79895075-79895097 CCTACAAGAGTGATATTATCCAT 0: 1
1: 0
2: 3
3: 12
4: 135
Right 1129983367 15:79895088-79895110 TATTATCCATTTTATAGACAAGG 0: 1
1: 1
2: 11
3: 118
4: 1281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129983366 Original CRISPR ATGGATAATATCACTCTTGT AGG (reversed) Intronic
904119405 1:28187089-28187111 TATGATAATATCACTCTTGAGGG - Intronic
908388451 1:63664065-63664087 TTGGATAATGACACACTTGTGGG - Intergenic
908804062 1:67911791-67911813 AAGGGTAATATAACTGTTGTTGG - Intergenic
909404177 1:75267987-75268009 ATGGATTCGGTCACTCTTGTTGG + Intronic
911743089 1:101409088-101409110 ATGCATAATATCACTACTCTTGG + Intergenic
914682343 1:149947542-149947564 ATAGATAATATCTATCCTGTAGG + Intronic
915024380 1:152813470-152813492 AAGGACAACATCACTTTTGTAGG - Intergenic
916478355 1:165191890-165191912 ATGCAGAGTATCACTCTTGTTGG - Intergenic
917888393 1:179411571-179411593 ATGTATAATGTAACTTTTGTGGG + Intronic
918320862 1:183363316-183363338 ATGGATTGTATCTCTCTTATAGG + Intronic
921614857 1:217254164-217254186 ATGGATGAGATCACTCTTCCAGG + Intergenic
1063070887 10:2662893-2662915 ATGGATTATGTCATTCTGGTTGG - Intergenic
1063349570 10:5341766-5341788 ATGGATAATATCTGCCCTGTAGG + Intergenic
1063698454 10:8360772-8360794 ATGAATAATTTCATTCTTGCAGG + Intergenic
1064711966 10:18137453-18137475 GTTGATAATATCACTGTTTTAGG - Intergenic
1064960601 10:20960185-20960207 ATGTATAATATAACTGTTTTTGG + Intronic
1069654806 10:70079867-70079889 AAGGATGATATGAATCTTGTAGG + Intronic
1071727072 10:88209726-88209748 AAAGATAAAATCAGTCTTGTTGG - Intergenic
1074639042 10:115357918-115357940 AATGATACTATCACTCTTTTAGG + Intronic
1075003593 10:118815164-118815186 GTGGATCAAATCACCCTTGTAGG + Intergenic
1075965327 10:126606257-126606279 ATGAATAATGTCACCCTTGTAGG + Intronic
1077339649 11:2020625-2020647 ATGGTCAAAATCACTCTTGTGGG - Intergenic
1078763102 11:14267653-14267675 ATGGGTAACATGACTCTTGTTGG + Exonic
1079793067 11:24764033-24764055 ATGGATAATATTTATTTTGTTGG + Intronic
1082913411 11:58403294-58403316 ATCTATATTATCACTCTGGTTGG - Exonic
1086407572 11:86511793-86511815 GTAGATAACATCACTATTGTAGG + Intronic
1088987584 11:114923555-114923577 ATGAGTAATGTCACTATTGTGGG - Intergenic
1202822634 11_KI270721v1_random:75814-75836 ATGGTCAAAATCACTCTTGTGGG - Intergenic
1093041281 12:14382517-14382539 ATGGAAAAAATAACTTTTGTAGG - Intronic
1093044814 12:14430929-14430951 ATAGATATTTTCAATCTTGTGGG - Intronic
1096365413 12:51025344-51025366 ATTGATAATATCAGTCTTACAGG - Intronic
1100172562 12:91992243-91992265 ATGGAAAATATCAAGCTTGCAGG - Intronic
1103230499 12:119326600-119326622 ATGGAAAACATCACTCATGGAGG + Intergenic
1109102345 13:58201037-58201059 ATTTATAATATCAGTCTTCTAGG + Intergenic
1111012562 13:82330429-82330451 ATGGATTATGTCACACTTGCAGG + Intergenic
1111065201 13:83081894-83081916 AAGGATAATCTGATTCTTGTTGG - Intergenic
1112703447 13:102038450-102038472 ATGGATAATATAACTGTTCCCGG - Intronic
1113659201 13:112093404-112093426 ATTGAAAATATCAATGTTGTTGG - Intergenic
1115273643 14:31582472-31582494 AAGGATCAGACCACTCTTGTGGG + Intronic
1117062606 14:51978834-51978856 ATAGATATTTTCACTTTTGTAGG - Intronic
1122427801 14:101621786-101621808 ATGAATAAAATGACTCTTCTCGG + Intergenic
1128443262 15:67733486-67733508 ATGGAGAAGATCACTTTTATTGG + Intronic
1129339600 15:74876585-74876607 ATGAATGATGTCTCTCTTGTAGG - Intergenic
1129983366 15:79895075-79895097 ATGGATAATATCACTCTTGTAGG - Intronic
1133602908 16:7357258-7357280 ATGGAGGATATCAGTCCTGTGGG + Intronic
1133836188 16:9369541-9369563 AGGGATTAAATGACTCTTGTAGG + Intergenic
1144038984 17:11391693-11391715 ATGGATAGTTTCACTGTTGCAGG + Intronic
1144455559 17:15415515-15415537 ATGGATAATATGACTTTACTGGG - Intergenic
1146596374 17:34172672-34172694 ATAGATAATGTCACCATTGTGGG - Intronic
1146982496 17:37177842-37177864 ATGGAGAGTATCAGACTTGTAGG - Intronic
1152824561 17:82456493-82456515 ATAGATAATATCAGTATTGCAGG + Intergenic
1154481335 18:14828889-14828911 ATGGATTATTTCACTCTTAGTGG + Intronic
1155750079 18:29412062-29412084 ATTGATAATATTACTTTTATTGG + Intergenic
1156391500 18:36654762-36654784 AAGGAAAATATCACTCCTGAGGG - Intronic
1158776419 18:60587474-60587496 TAGAATAATATCACTCATGTTGG + Intergenic
927071271 2:19532028-19532050 ATGGATCAAATTTCTCTTGTGGG - Intergenic
928481487 2:31688776-31688798 ATGTATTATGCCACTCTTGTGGG - Intergenic
933165046 2:79066364-79066386 ATGGGTAATAACACTCCTTTTGG - Intergenic
936879406 2:117232173-117232195 ATGGATAATATTGCTCTTTTAGG + Intergenic
936998473 2:118439678-118439700 ATGGGTAATATCACCCTTCAAGG + Intergenic
940246771 2:151627553-151627575 ATGGATGACATCATTCTGGTCGG + Exonic
940248250 2:151643848-151643870 ATGGATGACATCGCTCTGGTCGG + Exonic
943599889 2:189903725-189903747 ATGGATAACATCACCCAGGTAGG + Intronic
944306735 2:198187855-198187877 ATGGATGATATCACTGTTGTAGG + Intronic
947127189 2:226882047-226882069 ATGGATAATTTCTTTTTTGTTGG + Intronic
1170466107 20:16623723-16623745 AGGGATAAAATCACTATTATAGG - Intergenic
1170908245 20:20536965-20536987 ATGGAAAATATCACTGTACTTGG + Intronic
1173336676 20:42117666-42117688 ATTGACAATATCACTATTGGTGG + Intronic
1174435101 20:50500708-50500730 CTGGATAATATCACTGTCTTAGG + Intergenic
1177446116 21:21198030-21198052 CTGGTTCATATCACTCTTATGGG + Intronic
1180459690 22:15550990-15551012 CTGGAAAATATCACTCTTTGTGG + Intergenic
1182070582 22:27460935-27460957 ATGGATTGTTTCATTCTTGTGGG - Intergenic
952655477 3:35780434-35780456 TAGGCTAATATCTCTCTTGTAGG - Intronic
952723667 3:36559672-36559694 TAGGATAATACCACTCTTGGGGG - Intergenic
956160019 3:66341188-66341210 ATGGCTAATATCATTCTTAATGG - Intronic
964131345 3:153291130-153291152 TTGGATAACATCACACTTGATGG + Intergenic
965379154 3:167966890-167966912 ATGGATGATTTCTCTCTGGTGGG - Intergenic
965441645 3:168722203-168722225 ATGAATAATATCACTATCCTTGG - Intergenic
966042954 3:175514292-175514314 ATGAATATTATCACTAATGTTGG + Intronic
972721826 4:41707186-41707208 ATTTGTAATATCACTCCTGTGGG + Intergenic
972966981 4:44522589-44522611 AAGCATAATATCATTATTGTTGG - Intergenic
973030951 4:45338302-45338324 ATGGACAATATCCATCTTTTTGG - Intergenic
975172009 4:71243060-71243082 ATGGTTAATATCCCTCTTCTTGG - Intronic
977983634 4:103356818-103356840 ATGATTAATATCACTTTTGAGGG - Intergenic
978091371 4:104720468-104720490 ATGGTAAATCTCACTCTTTTTGG - Intergenic
978430652 4:108629524-108629546 ATGGATTCTATAACTCTTCTGGG + Intronic
979222099 4:118239139-118239161 ATGGAACATCCCACTCTTGTAGG - Intronic
982466299 4:155737328-155737350 ATGTATAATATGAGTTTTGTTGG - Intergenic
983672882 4:170258877-170258899 ATGGAGAATAACACTCCTTTTGG + Intergenic
983997973 4:174208562-174208584 ATGGAAAATATCAGTATTTTAGG + Intergenic
986778553 5:11042971-11042993 AAGGATACTATCTCTTTTGTTGG - Intronic
990080324 5:51904571-51904593 ATGGATAATACCACATATGTAGG - Intergenic
990779321 5:59341139-59341161 ATGGCTACTAGCTCTCTTGTTGG + Intronic
993521145 5:88902797-88902819 ATGGATAAAATCAATTTTCTGGG - Intronic
996161441 5:120172015-120172037 ATGGTTAATATCATTCTTAATGG - Intergenic
996634490 5:125673686-125673708 ATGGTTAATATCACTCTGACTGG + Intergenic
997302778 5:132818661-132818683 TGGGATAATTTCCCTCTTGTGGG - Intergenic
999898088 5:156056409-156056431 ATGAATAACATCAATATTGTAGG + Intronic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1003799737 6:9650084-9650106 ATGCAAAATATCACTGTGGTAGG - Intronic
1007090753 6:39183390-39183412 CTGGGTAATAACACTGTTGTGGG + Intergenic
1007132963 6:39493976-39493998 ATGGAGAATATTCCTCCTGTAGG - Intronic
1007855587 6:44852575-44852597 ATGAATACTATTTCTCTTGTGGG - Intronic
1008781639 6:55113593-55113615 ATGGATAAAATTACTCTTGCAGG - Intronic
1008837137 6:55847563-55847585 ATGAATAATAGCACTTTTTTTGG - Intronic
1011241245 6:85273406-85273428 CTGGATAATATTTCCCTTGTTGG + Intergenic
1013031925 6:106342241-106342263 TTGGTTAATGTCACTCTGGTGGG + Intergenic
1013085345 6:106852164-106852186 ATAGGTAATATCACTGTTGTAGG + Intergenic
1013381076 6:109571392-109571414 ATTGAAAATAACTCTCTTGTAGG + Intronic
1014553236 6:122813449-122813471 ATGATTAATTTCACTCTTGTAGG + Intergenic
1015017690 6:128434108-128434130 ATGGATAAAATTACTCCTGCAGG + Intronic
1015253149 6:131148310-131148332 ATGTATTATATGACTTTTGTGGG + Intronic
1018520978 6:164652048-164652070 ATAGATAATATCACACTTAATGG - Intergenic
1019956335 7:4417625-4417647 ATGGAAAATCTCTCTCTTGCTGG + Intergenic
1022263254 7:28727909-28727931 AGGGACAATATCTCTGTTGTGGG - Intronic
1022809749 7:33857205-33857227 ATGGAGAATTTCACCCTTCTTGG - Intergenic
1023136641 7:37059206-37059228 AGGGAAAATATCACTCCAGTGGG + Intronic
1025785973 7:64643614-64643636 CTGGATAATGTGACTCTTCTTGG + Intergenic
1026094809 7:67337204-67337226 ATGGATAAAATCAATTTTCTGGG + Intergenic
1026816907 7:73520688-73520710 GAGGATAATCTCATTCTTGTTGG - Intronic
1027520374 7:79199222-79199244 ATTAATATTATTACTCTTGTTGG - Intronic
1031734976 7:125347603-125347625 ATGAATAATAATACTCTTTTCGG + Intergenic
1033146030 7:138870696-138870718 ATGTAAAACATCACGCTTGTTGG - Intronic
1035789368 8:2289730-2289752 ATAGATAACATCACTGTTGCAGG + Intergenic
1035803437 8:2431975-2431997 ATAGATAACATCACTGTTGCAGG - Intergenic
1037480396 8:19299911-19299933 ATGGACAAAATAAGTCTTGTGGG - Intergenic
1037594068 8:20339759-20339781 ATGGACAATATCACTGTGGAAGG + Intergenic
1038160276 8:25030642-25030664 ATAGATAACATCACTATTGTAGG - Intergenic
1038599866 8:28929314-28929336 TTGGAAAATCTCATTCTTGTTGG + Intronic
1038904750 8:31887527-31887549 ATAGAGAAGATCACTCTCGTAGG + Intronic
1041351717 8:56953524-56953546 ATAAATAACATCACTATTGTGGG + Intergenic
1043157547 8:76803033-76803055 ATAGAAAATATCACACTTTTCGG - Intronic
1044031212 8:87240491-87240513 ATGAATAACCTCACTCTTTTTGG + Intronic
1044772210 8:95648211-95648233 ATAAATAATAAGACTCTTGTGGG - Intergenic
1044973362 8:97641311-97641333 ATGGAACATCTCACTCTTGTAGG + Intergenic
1045497786 8:102722708-102722730 ATGGATAAGATCACTCAGGGAGG - Intergenic
1046402783 8:113728085-113728107 ATGGAGAATATCTCACTTCTAGG + Intergenic
1050131550 9:2418017-2418039 GTTTATAATATAACTCTTGTTGG + Intergenic
1054732901 9:68718956-68718978 ATGGATAATATGACTCTATCTGG - Intronic
1055738819 9:79363302-79363324 ATGGCTAAAATCATTCTTGAGGG + Intergenic
1056238673 9:84621536-84621558 ATGGATAACATGACACTTTTAGG - Intergenic
1059033874 9:110732286-110732308 CTGGCTAAAATAACTCTTGTAGG - Intronic
1191991939 X:67047332-67047354 ATGGATAATATCAAGCTTCATGG - Intergenic
1193855969 X:86602508-86602530 ATTGGTAATATCAGTTTTGTTGG + Intronic
1195638392 X:107144926-107144948 AGGGATAATATCTATCTTTTAGG - Intronic
1197131937 X:123015289-123015311 ATGGTTAAAATCACTTTTGGAGG - Intergenic
1197784236 X:130184940-130184962 ATGGAGAATATCACTCTAGTAGG - Intergenic
1198014631 X:132596458-132596480 CTTGATAATTTCACTATTGTTGG - Intergenic
1198040923 X:132851658-132851680 ATGGACAATATCACCCTTGTTGG - Intronic
1199168261 X:144703309-144703331 ATGGAAAATAGTAGTCTTGTTGG + Intergenic
1202081193 Y:21085781-21085803 ATGGAAAATATCAGCCCTGTGGG - Intergenic