ID: 1129983546

View in Genome Browser
Species Human (GRCh38)
Location 15:79896708-79896730
Sequence ACTAGGGGGCGTGCGCGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129983532_1129983546 21 Left 1129983532 15:79896664-79896686 CCGGGCCCTCTCCCCGCCATAGT 0: 1
1: 0
2: 1
3: 27
4: 193
Right 1129983546 15:79896708-79896730 ACTAGGGGGCGTGCGCGCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 40
1129983538_1129983546 5 Left 1129983538 15:79896680-79896702 CCATAGTGCCAAGAGCGTCCAGA 0: 1
1: 0
2: 1
3: 3
4: 50
Right 1129983546 15:79896708-79896730 ACTAGGGGGCGTGCGCGCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 40
1129983536_1129983546 9 Left 1129983536 15:79896676-79896698 CCCGCCATAGTGCCAAGAGCGTC 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1129983546 15:79896708-79896730 ACTAGGGGGCGTGCGCGCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 40
1129983537_1129983546 8 Left 1129983537 15:79896677-79896699 CCGCCATAGTGCCAAGAGCGTCC 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1129983546 15:79896708-79896730 ACTAGGGGGCGTGCGCGCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 40
1129983534_1129983546 15 Left 1129983534 15:79896670-79896692 CCTCTCCCCGCCATAGTGCCAAG 0: 1
1: 0
2: 0
3: 8
4: 279
Right 1129983546 15:79896708-79896730 ACTAGGGGGCGTGCGCGCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 40
1129983535_1129983546 10 Left 1129983535 15:79896675-79896697 CCCCGCCATAGTGCCAAGAGCGT 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1129983546 15:79896708-79896730 ACTAGGGGGCGTGCGCGCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 40
1129983533_1129983546 16 Left 1129983533 15:79896669-79896691 CCCTCTCCCCGCCATAGTGCCAA 0: 1
1: 0
2: 0
3: 3
4: 114
Right 1129983546 15:79896708-79896730 ACTAGGGGGCGTGCGCGCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 40
1129983539_1129983546 -3 Left 1129983539 15:79896688-79896710 CCAAGAGCGTCCAGACCACGACT 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1129983546 15:79896708-79896730 ACTAGGGGGCGTGCGCGCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129983546 Original CRISPR ACTAGGGGGCGTGCGCGCGC CGG Intronic
922785696 1:228281298-228281320 CCTTGGGGGCGTGCGTGCCCTGG + Intronic
1065520478 10:26567005-26567027 ACTTGGGGGCGTGCGGGGCCCGG - Exonic
1068444646 10:57106004-57106026 ACTAGGGGGCCTGAGCTTGCAGG + Intergenic
1069680775 10:70283830-70283852 AGCAGGGGGCGTGCGCTCCCAGG + Intergenic
1070942100 10:80357006-80357028 AGGAGGGGGCGTGCAGGCGCGGG + Intronic
1072637266 10:97185974-97185996 CGCAGGGTGCGTGCGCGCGCGGG - Intronic
1087296958 11:96389387-96389409 ACTAGTGGGCTAGCGGGCGCTGG - Intronic
1090788364 11:130069622-130069644 GCGCGGGGGCGTGCGCGCGGCGG - Intergenic
1092230687 12:6773907-6773929 ACTCGCCGGCGTCCGCGCGCCGG - Exonic
1095876159 12:47080919-47080941 AGTAAGGGGCGTGTGCGCGGAGG + Intronic
1098161067 12:67648731-67648753 GCGCGGGGGCGCGCGCGCGCGGG + Exonic
1101910595 12:108857733-108857755 ACGAGGAGGCGCGCGTGCGCGGG + Intergenic
1105409707 13:20161318-20161340 ACTCCGGGGCATGCCCGCGCGGG + Intergenic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1114422721 14:22598204-22598226 GCAAGGGGGCGTGGCCGCGCAGG - Intergenic
1122630437 14:103105111-103105133 AGCAGGGGGCGCGCGAGCGCCGG + Intronic
1126039785 15:44578652-44578674 ACTAGGTGGCGTGCACACACAGG + Intronic
1129983546 15:79896708-79896730 ACTAGGGGGCGTGCGCGCGCCGG + Intronic
1136109351 16:28054972-28054994 AGTAGGGGGCCTGCGGGGGCTGG - Intronic
1140033862 16:71358639-71358661 AGAAGGGGGCGCGCGCGCTCAGG - Intergenic
1142429750 16:90019575-90019597 AGCAGGGGGCGCGCGCGGGCCGG - Intronic
1146184337 17:30715280-30715302 ACTAGGGGGCGTTCTGGGGCAGG - Intergenic
1149712412 17:58755746-58755768 AGTTGGTGGCGGGCGCGCGCAGG - Intergenic
1150568555 17:66364613-66364635 AGTAGGGGGAGTGCGGGAGCAGG + Intronic
1152352514 17:79791479-79791501 ACTCGGGGGCGGGGGTGCGCGGG + Intergenic
1157278948 18:46333612-46333634 ACTCGGGGACGTGCGCTCGGAGG - Intronic
1162974439 19:14200394-14200416 ACTAGGGGGCGTTCTGGGGCAGG + Intronic
939153805 2:138501759-138501781 GCGAGGGCGCGTGCGCGCGGCGG - Intergenic
941905258 2:170713427-170713449 AGAAGGGGGCGTGCGAGTGCAGG + Exonic
944630511 2:201619218-201619240 ACTAGGCGGCACGCACGCGCTGG - Intergenic
1182278734 22:29206182-29206204 AGGTGGGGGCGTGTGCGCGCCGG - Intronic
952344076 3:32467985-32468007 GCCAGGGGGCGTGCGCGGCCAGG - Intronic
969362546 4:6673940-6673962 GCAAGTGCGCGTGCGCGCGCAGG + Intergenic
976068415 4:81215333-81215355 GCTAGTGTGCGTGCGGGCGCGGG - Intergenic
979231378 4:118352477-118352499 CCTGGAGGGCGTGCGGGCGCTGG + Exonic
988822946 5:34905747-34905769 ACTAGGGGGAGTGCTCCCTCAGG - Exonic
1004562100 6:16760931-16760953 GCTAGGGGGCGCGCCCGGGCGGG - Intronic
1028838055 7:95396448-95396470 AGTAGGAGGCGTGTGCGGGCGGG - Intergenic
1029813861 7:103074820-103074842 ACTAGGGGCCGGGCGCGTGCGGG + Intronic
1034680689 7:152925478-152925500 CCGAGGGGCCGGGCGCGCGCGGG + Intergenic
1057199772 9:93133920-93133942 ACGAGGGGGCGTGGGGGCGCAGG - Intronic
1057488767 9:95506645-95506667 GCAAGCGGGCGTGGGCGCGCGGG - Intronic
1062467421 9:136687418-136687440 AATAAGGGGCCTGAGCGCGCGGG - Exonic