ID: 1129983712

View in Genome Browser
Species Human (GRCh38)
Location 15:79897291-79897313
Sequence CGCTGCCGCCTCCGCGGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 511}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129983712_1129983721 6 Left 1129983712 15:79897291-79897313 CCGGGACCGCGGAGGCGGCAGCG 0: 1
1: 0
2: 2
3: 40
4: 511
Right 1129983721 15:79897320-79897342 GCGGGGATGGTAAAGATGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 122
1129983712_1129983722 18 Left 1129983712 15:79897291-79897313 CCGGGACCGCGGAGGCGGCAGCG 0: 1
1: 0
2: 2
3: 40
4: 511
Right 1129983722 15:79897332-79897354 AAGATGGCCGGCAGTACCCACGG 0: 1
1: 0
2: 1
3: 3
4: 72
1129983712_1129983718 -7 Left 1129983712 15:79897291-79897313 CCGGGACCGCGGAGGCGGCAGCG 0: 1
1: 0
2: 2
3: 40
4: 511
Right 1129983718 15:79897307-79897329 GGCAGCGCCACTGGCGGGGATGG 0: 1
1: 0
2: 1
3: 26
4: 235
1129983712_1129983720 2 Left 1129983712 15:79897291-79897313 CCGGGACCGCGGAGGCGGCAGCG 0: 1
1: 0
2: 2
3: 40
4: 511
Right 1129983720 15:79897316-79897338 ACTGGCGGGGATGGTAAAGATGG 0: 1
1: 0
2: 2
3: 9
4: 144
1129983712_1129983724 25 Left 1129983712 15:79897291-79897313 CCGGGACCGCGGAGGCGGCAGCG 0: 1
1: 0
2: 2
3: 40
4: 511
Right 1129983724 15:79897339-79897361 CCGGCAGTACCCACGGTGCCTGG 0: 1
1: 0
2: 0
3: 30
4: 896

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129983712 Original CRISPR CGCTGCCGCCTCCGCGGTCC CGG (reversed) Intronic
900427382 1:2586815-2586837 CGCTCCCGGCTCCTCGCTCCTGG - Exonic
900568194 1:3345729-3345751 TGCTGCCCCCTCTGTGGTCCAGG + Intronic
900568210 1:3345772-3345794 TGCTGCCCCCTCTGTGGTCCAGG + Intronic
901313795 1:8291477-8291499 CGCTGCAGCCTCTGCTGCCCGGG + Intergenic
901920366 1:12531896-12531918 CGCTGCAGCCTCCGCCCCCCAGG + Intergenic
902289144 1:15425447-15425469 CGCTGCAGCCTCCGCCTCCCGGG - Intronic
903223499 1:21881865-21881887 CGCTGCAGCCTCCGCCTCCCGGG - Intronic
903310470 1:22451567-22451589 CACTGCAGCCTCCGCCTTCCAGG - Intergenic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903418277 1:23199779-23199801 CACTGCAGCCTCCGCCTTCCGGG + Intergenic
903777141 1:25800350-25800372 CGCCGCTGCCGCCGCCGTCCGGG + Exonic
903835657 1:26201763-26201785 CGCTGCCACCTCTGCGGCCTGGG + Intronic
903875863 1:26472677-26472699 CGCCGCCGCCTCCCTGGTGCAGG + Intronic
904128826 1:28260535-28260557 GGCTGCCGCCGCCGCGTACCGGG - Intronic
904569967 1:31456150-31456172 CGCCGCCCCCTCCACGGTCATGG - Intergenic
904652208 1:32014108-32014130 CGCCGCTGCCTCACCGGTCCCGG + Exonic
905559712 1:38916793-38916815 CACTGCAACCTCCGCTGTCCAGG - Intronic
905679655 1:39859505-39859527 CGCTGCAGCCTCCGCCTTCCAGG - Intronic
905752391 1:40477349-40477371 CGCTGCAGCCCTGGCGGTCCCGG - Exonic
906313150 1:44768184-44768206 CACTGCCGCCTCCGCCTCCCGGG - Intergenic
906637010 1:47416484-47416506 CGCCGCCGCCGCCCCGGGCCGGG - Exonic
908355902 1:63324317-63324339 CGCTGCCGACTGCACGGTCCCGG - Exonic
910880450 1:91918341-91918363 CACTGCCACCTCCGCCTTCCGGG + Intergenic
911664732 1:100539689-100539711 CGCCGCCGCCGCCGCCTTCCCGG + Exonic
912829878 1:112943330-112943352 CACTGCAGCCTCCGCCTTCCAGG - Intronic
914376707 1:147078985-147079007 CTTTGCCGCCTCTGCCGTCCCGG + Intergenic
914538586 1:148589806-148589828 CACTGCCACCTCTGCCGTCCGGG + Intronic
914736049 1:150418041-150418063 CGCTGCAGCCTCCGCCTCCCGGG + Intronic
915351030 1:155226177-155226199 CACTGCAGCCTCCGCCTTCCAGG - Intergenic
916065508 1:161132647-161132669 CGCCGCCGCCGCCGCGGCCGTGG + Exonic
916797580 1:168181056-168181078 CACTGCAGCCTCCGCCTTCCAGG + Intronic
918174385 1:182030033-182030055 CGCTGCCTGCTCCGCTCTCCAGG - Intergenic
919549861 1:198971653-198971675 CACTGCAGCCTCCGCCTTCCAGG + Intergenic
919642405 1:200058554-200058576 CACTGCAGCCTCCGCCTTCCCGG + Intronic
919716770 1:200786457-200786479 CGCTGCAGCCTCCGCCTCCCGGG + Intronic
920084065 1:203401666-203401688 CGCTGGCGTCTCCGCTGTCCTGG - Intergenic
920704851 1:208243604-208243626 CGCTGCCGACTCCGAGCGCCCGG + Intronic
921023823 1:211259632-211259654 CGCTGCCGCCGCCGCCTGCCGGG - Exonic
921046105 1:211479072-211479094 CACCGCCGCCACTGCGGTCCTGG - Exonic
921155066 1:212432953-212432975 CGCAGCCGCCGCCGCGGCGCGGG - Exonic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921229930 1:213059587-213059609 CACTGCAGCCTCCGCCTTCCGGG + Intronic
922434116 1:225586176-225586198 CACTGCAGCCTCCGCCTTCCGGG - Intronic
922558193 1:226548927-226548949 CGCCGCCGCCGCCGCCGTCTCGG - Exonic
923171638 1:231422210-231422232 CGCCGCCGCCTCAGCGTCCCGGG + Exonic
923182260 1:231530810-231530832 CACTGCAACCTCCGCGTTCCGGG - Intronic
924819911 1:247479341-247479363 CACTGCAGCCTCCGCCTTCCAGG + Intergenic
1062863719 10:831491-831513 CCCTGCCGGCTCTGCGGCCCAGG - Intronic
1063619392 10:7631860-7631882 CGCTGCAGCCTCCGCCTCCCGGG + Intronic
1063659855 10:8027532-8027554 CACTGCAGCCTCCGCGTCCCGGG + Intergenic
1064033997 10:11900779-11900801 CACTGCAGCCTCCGCCTTCCGGG - Intergenic
1064086506 10:12349650-12349672 CGCCGCCGCCGCCGCGGCCGCGG - Exonic
1064136706 10:12757204-12757226 CACTGCAGCCTCAGCCGTCCCGG + Intronic
1065600162 10:27359631-27359653 CGCTGCAACCTCCGCCTTCCAGG - Intergenic
1066406904 10:35127071-35127093 CGCTGCCGGCTCCGGGTTGCTGG + Intronic
1066464523 10:35640838-35640860 CCCTGCCGCCGCCGCGGTGCGGG + Exonic
1067077458 10:43196362-43196384 CACTGCCGCGTCCCTGGTCCAGG - Intronic
1067346921 10:45443873-45443895 CGCTGCCTCCTCCCCCGCCCCGG + Intronic
1067416355 10:46106240-46106262 CCCCGCCGCCTCCGCTCTCCTGG - Intergenic
1068953950 10:62805122-62805144 CGCGGCCGCCCCCGCTGCCCCGG - Exonic
1069019171 10:63466092-63466114 CGCTGCCGCCTCCGCAGGGCCGG - Intergenic
1069511194 10:69043651-69043673 CACTGCAGCCTCCGCCTTCCGGG - Intergenic
1070902652 10:80044199-80044221 CTCTGCAGCCTCCCCTGTCCAGG - Intergenic
1071086636 10:81874555-81874577 CGCTGTCGCCGCCGCGAGCCAGG - Intergenic
1071142969 10:82534337-82534359 CGCTGCAACCTCCGCGCTCCCGG + Intronic
1071258208 10:83894269-83894291 CACTGCCGCCTCCGCCTCCCAGG + Intergenic
1071618185 10:87094996-87095018 CGCTGCCGCCAGCGAGGCCCGGG - Intronic
1072081310 10:92034832-92034854 CACTGCAGCCTCCGCCTTCCAGG - Intergenic
1072105280 10:92267892-92267914 CACTGCCGCCTCCGCCTCCCGGG + Intronic
1072720464 10:97777803-97777825 CGCTGTTGCCTCCCCTGTCCCGG + Intergenic
1073245480 10:102087391-102087413 CACTGCAGCCTCCGCGTCCCGGG + Intergenic
1073501041 10:103937483-103937505 CGCTGCAGCCTCCGCCTCCCAGG + Intergenic
1074169678 10:110919828-110919850 CGCCGCCGCCGCCGCTTTCCTGG + Intronic
1074169718 10:110919950-110919972 CGCCGCCGCCGCCGCAGGCCCGG - Intronic
1074182578 10:111077294-111077316 CCCCGCCGCCGCCGCCGTCCCGG + Exonic
1074567951 10:114598196-114598218 CGCTGCAACCTCCGCCTTCCGGG - Intronic
1074758790 10:116648407-116648429 CACTGCAGCCTCCGCCTTCCAGG - Intergenic
1074814504 10:117134310-117134332 CGCAGCCGCCGCCGCCGCCCCGG - Exonic
1074866417 10:117546667-117546689 CACCGCCGCCTCGGCTGTCCAGG - Intronic
1074951543 10:118342092-118342114 CGCCGTCGCTTCCGCGGCCCCGG + Intronic
1075129495 10:119726069-119726091 CGCTGCCGCCGCCGCTGCCGGGG + Intergenic
1075567309 10:123514044-123514066 CGCTGCAGCCTCCCTGGTCCTGG + Intergenic
1076754056 10:132558867-132558889 CGCTGCAGCCTCCGGGGCCATGG + Intronic
1076997881 11:307822-307844 CGCTGACGCCTCCACACTCCAGG - Intronic
1077000776 11:321172-321194 CGCTGACGCCTCCACACTCCAGG + Intronic
1077008377 11:369544-369566 CGCTCCCGGCTCCGCGCTCCTGG - Intergenic
1079689409 11:23403540-23403562 CGCCGCCGCCGCCGCGGGACGGG + Intergenic
1081779943 11:45703245-45703267 CGCTGCCGCCCCTGCTTTCCTGG - Intergenic
1082086925 11:48057985-48058007 CGCTGCAGCCTCCGCCTCCCGGG + Intronic
1083137554 11:60692970-60692992 CACTGCAGCCTCCGCCTTCCAGG - Intergenic
1083710163 11:64543015-64543037 CGCTGCCGCCTCCCCGGGCCCGG - Intergenic
1084186995 11:67478668-67478690 CACTGCAGCCTCCGCCTTCCAGG + Intergenic
1084680102 11:70662033-70662055 CGCTGCCGCCGCCGCCGTTCGGG - Intronic
1085208108 11:74749193-74749215 CGCTGCCGCGCCCGCGGCCCAGG + Exonic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1086159415 11:83704749-83704771 CACTGCCACCTCCGCCTTCCAGG - Intronic
1087301974 11:96446727-96446749 CGCTGCAGCCTCCGCCTCCCAGG + Intronic
1087586424 11:100127732-100127754 CACTGCCACCTCCGCCTTCCAGG + Intronic
1088283351 11:108160245-108160267 CACTGCAGCCTCCGCCTTCCAGG - Intronic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1090788470 11:130069988-130070010 GGCTGCGGCGGCCGCGGTCCCGG - Exonic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1092518439 12:9240414-9240436 CGCAGCCGCCTCCGCCGCCGCGG - Intergenic
1092868126 12:12782181-12782203 CACTGCAGCCTCCGCCTTCCAGG - Intronic
1093729288 12:22549428-22549450 CACTGCCGCCTCCGCCTCCCAGG + Intergenic
1093958791 12:25250896-25250918 CGCTGCTGCCTCCGCCGCCGCGG + Intronic
1094348461 12:29497579-29497601 CTCAGCCTCCTCCGCAGTCCTGG + Intronic
1094653429 12:32399389-32399411 CGCCGCCGCCTCCTCCGGCCGGG - Intergenic
1095261597 12:40105313-40105335 CACCGCCGGCTCCGCGGTGCTGG - Exonic
1095939321 12:47715938-47715960 CTCAGCCACCTCCGCGATCCTGG - Intronic
1096105438 12:48994866-48994888 AGCTGCCGGCTCCGCGGGCGCGG - Intergenic
1096142995 12:49257932-49257954 CACTGCAGCCTCCGCCTTCCGGG + Intronic
1096260097 12:50085170-50085192 CCCTCCCGCCTTCACGGTCCGGG - Exonic
1096559367 12:52424672-52424694 CGCTGCCCCCACCGAGGCCCAGG + Exonic
1096749950 12:53752162-53752184 CGCCGCCGCCGCCGCCTTCCAGG + Intergenic
1096992295 12:55814791-55814813 CGCTGCAACCTCCGCCTTCCAGG - Intronic
1098426061 12:70366537-70366559 CGCTGCCGCCGCCGCCGCCGGGG + Exonic
1098957240 12:76700217-76700239 CACTGCGACCTCCGCTGTCCAGG + Intergenic
1099840066 12:87954302-87954324 CACTGCAGCCTCCGCCTTCCGGG + Intergenic
1100089705 12:90954682-90954704 CGCCGCCGCCACCGCCGCCCAGG + Exonic
1100199657 12:92284666-92284688 CGCTGCAGCCTCCGCCTCCCAGG - Intergenic
1102686259 12:114727193-114727215 CACTGCAGCCTCCGCCTTCCGGG + Intergenic
1103074158 12:117968909-117968931 TGCTGCCGCCGCCGGGCTCCGGG + Intronic
1103481989 12:121256301-121256323 CACTGCAACCTCCGCTGTCCAGG - Intronic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1104463078 12:128970607-128970629 CGCTGCCCCCTCCTCGTTCCAGG + Intronic
1104835298 12:131786441-131786463 CACTGCCTCCTCCCCTGTCCAGG + Exonic
1105409701 13:20161303-20161325 CCCTGCCGCCTACGCACTCCGGG + Intergenic
1106568508 13:30906688-30906710 CGCCGCCGGCTCCCCGGGCCTGG - Exonic
1107113916 13:36726471-36726493 CACTGCAGCCTCCGCCCTCCTGG + Intergenic
1107779105 13:43879516-43879538 CGCTGCTGCCTCAGCAGTTCCGG - Exonic
1108314093 13:49221002-49221024 CGCCGCGGCCTCCGCGGTCTCGG - Exonic
1110215093 13:73016782-73016804 CACTGCAGCCTCCGCCTTCCAGG + Intergenic
1112192071 13:97187831-97187853 CACTGCAGGCTCCGCCGTCCCGG - Intergenic
1113885119 13:113654749-113654771 GGCTGCCGCCTCCTCGGCTCTGG - Intronic
1113904656 13:113813577-113813599 CTCTGCCCCCTCCGCTGCCCGGG + Exonic
1115399317 14:32939415-32939437 CGCCGCCGCCTCCGCCGCCGAGG + Intronic
1115566593 14:34630062-34630084 CGCTGCCCCCACCGCGCTCCCGG + Intronic
1116291067 14:43041401-43041423 CACTGCAGCCTCCGCACTCCTGG + Intergenic
1117690391 14:58299346-58299368 CGCTGCCGCCACCGCGGGCCCGG + Intronic
1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG + Intronic
1118208083 14:63742241-63742263 CACTGCCTCCTCCGCCTTCCGGG + Intergenic
1118849476 14:69573079-69573101 CGCCGCCGCCGCCGCGGCCTCGG - Exonic
1119623954 14:76154457-76154479 AGCTGCCGCCTCTGCTGTCGGGG - Exonic
1121279385 14:92688180-92688202 CGCCGCCGCCACCACCGTCCAGG - Exonic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1122558352 14:102593194-102593216 GGCAGCCGCCCCCGCGGCCCCGG + Intronic
1125428637 15:39574963-39574985 CTCTGCAGCCTCCGCCTTCCGGG + Intergenic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1126785489 15:52174995-52175017 CGCTGCAACCTCCGCATTCCAGG - Intronic
1126837255 15:52679442-52679464 CCCGGCGGCCTCCGCGGCCCTGG + Intronic
1128028573 15:64460584-64460606 CGCCGCCGCCGCCGCGATCCGGG - Intergenic
1128949439 15:71860889-71860911 CACTGCAGCCTCCGCCTTCCAGG - Intronic
1129285308 15:74519804-74519826 CACTGCAGCCTCCGCCTTCCAGG - Intergenic
1129347201 15:74930001-74930023 CACTGCAACCTCCGCCGTCCAGG - Intronic
1129350404 15:74952650-74952672 CACTGCCGCCTCCGCCTCCCAGG - Intergenic
1129893779 15:79089476-79089498 CGCCGCCGCCGCCGCAGTCGCGG - Intronic
1129983712 15:79897291-79897313 CGCTGCCGCCTCCGCGGTCCCGG - Intronic
1131242186 15:90756177-90756199 CACTGCAGCCTCCGCCTTCCAGG + Intronic
1132015477 15:98312631-98312653 CACTGCAGCCTCCGCCTTCCAGG - Intergenic
1132884857 16:2178249-2178271 CGCTGCCCCATCCCTGGTCCCGG + Exonic
1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG + Exonic
1133216339 16:4294549-4294571 TGCTGCCCCCTCCACGGGCCTGG + Intergenic
1133232219 16:4372159-4372181 CGCTCCCTCCCCCGCCGTCCTGG + Intronic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1133966337 16:10534688-10534710 CGCTGCAACCTCCGCCTTCCGGG - Intronic
1133998034 16:10762539-10762561 CCCGCCCGGCTCCGCGGTCCTGG - Intronic
1134290529 16:12900786-12900808 CGGCGCCGCCTCTGCGCTCCCGG - Intergenic
1134344599 16:13377955-13377977 CACTGCCACCTCCGCCTTCCAGG - Intergenic
1135697923 16:24606590-24606612 CACTGCAGCCTCCGCGTCCCGGG + Intergenic
1135821887 16:25692388-25692410 CGCCGCCGCCGCCGCGAGCCGGG + Exonic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1136485936 16:30571670-30571692 AGCCGCCGCCTCCCCGCTCCCGG + Exonic
1136622859 16:31442016-31442038 CTCAGCCGCCTCCCCCGTCCCGG - Intronic
1137036527 16:35574078-35574100 AGCAGCCGCCTCCGCGCTTCTGG - Intergenic
1137412938 16:48244657-48244679 CGCGGCCTCCTCCGGGGACCTGG + Intronic
1137454844 16:48610185-48610207 CTTTGCCGCCGCCGCGGGCCGGG + Exonic
1137614565 16:49838915-49838937 CGGGGCCGCCCCCGCGGGCCGGG + Intronic
1137617783 16:49857294-49857316 CGCCGCCGCCACCACGGTCCGGG - Intronic
1138011918 16:53389173-53389195 CACTGCAGCCTCCGCCGCCCAGG - Intergenic
1138369959 16:56519253-56519275 CGCTGCAGCCTCCGCCTCCCGGG - Intronic
1139383628 16:66549955-66549977 CGCTGCACCCTCCGCGGCCCGGG + Exonic
1139470322 16:67174765-67174787 CTCTGGCTCCTCCGGGGTCCCGG - Exonic
1139872656 16:70119990-70120012 CGCTGCAGCCTCCGCCTCCCGGG + Intronic
1139952759 16:70680088-70680110 CGCTGGGGCCTGCGCAGTCCCGG + Intronic
1140153369 16:72395907-72395929 CACTGCAGCCTCCGCTGCCCAGG - Intergenic
1140222984 16:73057854-73057876 CGCGGCCGCCACCGCTGGCCGGG - Intronic
1140463579 16:75161141-75161163 CACTGCCACCTCCGCCTTCCGGG + Intronic
1140865660 16:79059564-79059586 CACTGCAGCCTCCGCCTTCCGGG + Intronic
1141054616 16:80804017-80804039 CGCCGCCGCCGCCGCGGGCTCGG + Intronic
1141541780 16:84728872-84728894 CACTGCAGCCTCCGCCTTCCAGG + Intronic
1141582724 16:85011324-85011346 CGCCGCCGCCGCCGCAGGCCGGG - Exonic
1141608590 16:85169273-85169295 CGCCGCCGCCGCCGCGTTCCGGG + Intergenic
1141979200 16:87539358-87539380 ACCTGCTGCCTCCGCGGTGCGGG + Intergenic
1141984695 16:87572160-87572182 CCCTGCAGCCTCCGCCTTCCGGG + Intergenic
1142177283 16:88651050-88651072 CACTGCCGCCCCTGCGCTCCCGG + Exonic
1142259231 16:89034852-89034874 GGCTGCGGCCTCCTCTGTCCTGG + Intergenic
1142346920 16:89560099-89560121 CACTGCAGCCTCCGCGTCCCAGG - Intergenic
1142367512 16:89657842-89657864 CGCTCCCGGCTCCGCGGCCGCGG + Exonic
1142594957 17:1025218-1025240 CGCTGCAGCCTCCGCCTCCCGGG - Intronic
1143160616 17:4867734-4867756 CACTGCCACCTCCGCCTTCCAGG - Intronic
1145236783 17:21214101-21214123 CGCTGCCGCCACTGCTGCCCGGG + Exonic
1145875594 17:28316766-28316788 GGCTGCCGGCTCTGTGGTCCTGG + Intergenic
1145882128 17:28360041-28360063 CACTGCGGCCTCCGCCTTCCAGG + Intronic
1146398590 17:32487092-32487114 CGGCCCCGCCGCCGCGGTCCCGG - Exonic
1146720442 17:35119848-35119870 CGCTGCCGCTTCCGGGTTCCAGG + Intronic
1147047056 17:37760666-37760688 CACTGCAGCCTCCGCGTCCCAGG + Intergenic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147228315 17:38998376-38998398 CACTGCAACCTCCGCAGTCCCGG + Intergenic
1147257397 17:39190038-39190060 CACTGCAGCCTCCGCCTTCCAGG - Intronic
1147393420 17:40123098-40123120 CGCTGCCACCGCCTCGGACCCGG + Intronic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1147993486 17:44349257-44349279 AGCTGGCTCCTCCGGGGTCCAGG - Exonic
1148035448 17:44656487-44656509 CGCAGCCGCCTCCGCCGCCCGGG - Exonic
1148323638 17:46771484-46771506 CCCCGCCGCCCCCGCGTTCCCGG - Intronic
1148664098 17:49361919-49361941 CGCCTCCGCCTCCGCCGCCCCGG + Intronic
1148786920 17:50150085-50150107 CGCCGCCGCACCCGCCGTCCCGG - Exonic
1149296376 17:55265605-55265627 CGCTGCCGCGGCCCCGCTCCGGG + Intronic
1149429577 17:56586888-56586910 CACTGCAGCCTCTGCTGTCCAGG - Intergenic
1149599652 17:57885279-57885301 CGCTGCTGCCACCGCCCTCCAGG + Exonic
1149659050 17:58324871-58324893 CGCTCCCGCTCCCGCCGTCCTGG - Exonic
1149827993 17:59847190-59847212 CACTGCAGCCTCCGCCTTCCAGG + Intergenic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1150095869 17:62374383-62374405 CGCTGCAACCTCCGCCTTCCAGG - Intronic
1150239857 17:63622666-63622688 CGCTGCCGTCCCCGCCGCCCGGG + Exonic
1150378991 17:64706015-64706037 CACTGCAACCTCCGCTGTCCAGG + Intergenic
1150643450 17:66964575-66964597 CCCCGCCGCCGCCGCGCTCCGGG - Intergenic
1150869518 17:68890592-68890614 CACTGCAACCTCCGCAGTCCAGG + Intronic
1152074800 17:78152408-78152430 CGCTGCAGCCTCCACCTTCCAGG + Intronic
1152369192 17:79875220-79875242 CGCTGCAGCCTCCGCCTCCCGGG + Intergenic
1152461776 17:80445559-80445581 CTCTCCCGCCCCCGCGCTCCCGG - Intergenic
1152521984 17:80862019-80862041 CGCTGCAGCCTCCGTGCTCATGG - Intronic
1152979818 18:266611-266633 CACTGCAACCTCCGCTGTCCGGG + Intronic
1153198522 18:2626302-2626324 CGCTGCCACCTCCGCCTGCCAGG - Intergenic
1153305488 18:3626821-3626843 CACTGCAGCCTCCGCCCTCCCGG - Intronic
1153555112 18:6303936-6303958 CGCTGCAACCTCCGCCTTCCGGG - Intronic
1153636612 18:7117998-7118020 CGCGGCCGCCTCCCCGGCTCCGG + Intergenic
1154192319 18:12241123-12241145 CACTGCAGCCTCCGCCTTCCAGG + Intergenic
1154247630 18:12713833-12713855 CACTGCAGCCTCTGCCGTCCTGG + Intronic
1155204512 18:23546171-23546193 CGCTGCAGCCTCTGCCTTCCAGG - Intronic
1156578118 18:38343034-38343056 CGCTGCAGCCTCCGCCTCCCAGG - Intergenic
1157095099 18:44680204-44680226 CGCCGCCGCCTCCGCGCGCCCGG + Intronic
1157662819 18:49460480-49460502 CGCTGTCGCCGCCGCAGCCCAGG + Exonic
1157867118 18:51197006-51197028 CTCGGCCGCCTCCGGGGCCCCGG + Exonic
1158451879 18:57574078-57574100 CGCTGCAACCTCCGCCTTCCAGG + Intronic
1158954699 18:62526615-62526637 CGCCGCCGCCGCCGCGCACCCGG + Intronic
1160698656 19:496349-496371 CTCTGCCGCCTCCAGGGTCGGGG + Intronic
1160747586 19:719293-719315 CGCAGAGGCCTCCGCGGTGCGGG - Intronic
1160859059 19:1230075-1230097 CGCTGCCCGCGCCGCGCTCCGGG + Exonic
1161554667 19:4934097-4934119 CACTGCAGCCTCCGCCTTCCAGG + Intronic
1161691543 19:5737772-5737794 CGCTGCAGCCTCCGCCTCCCAGG - Intronic
1161862813 19:6811109-6811131 CACTGCAGCCTCCGCCTTCCAGG + Intronic
1161943643 19:7421004-7421026 CACTGCCGCCTCCACCTTCCGGG + Intronic
1161971396 19:7583029-7583051 CGCTGCAGCCTCCGCCTCCCGGG + Intergenic
1162100252 19:8334813-8334835 CGCGTCCGCCTCCACGGTCTCGG + Exonic
1162213186 19:9109713-9109735 CACTGCAGCCTCCGCCTTCCAGG + Intergenic
1162410684 19:10503258-10503280 CGCGGGCGCCTCCGCCGTCGGGG + Exonic
1162598864 19:11651335-11651357 CGCTGCAGCCTCCACCTTCCAGG - Intergenic
1163155029 19:15435140-15435162 CACTGCAGCCTCCGCTGCCCAGG - Intronic
1163708554 19:18832095-18832117 CGCTGTCGCCCCCGCGCGCCCGG - Exonic
1163715158 19:18869025-18869047 CCCTGCCGCCTGCGCGCGCCTGG - Exonic
1163753887 19:19095123-19095145 CACTGCAGCCTCCGCCTTCCAGG - Intronic
1163827644 19:19532628-19532650 GGCGGCTGCCTCCGCGGTGCTGG - Exonic
1164658635 19:29942684-29942706 CGCTTCCGCCTCCGCCCGCCGGG + Intronic
1164834726 19:31349766-31349788 CGCAGCCGCCGCCGCGGCCCGGG + Intergenic
1165042185 19:33076471-33076493 CACTGCAGCCTCCGCTGCCCGGG - Intergenic
1165219487 19:34303689-34303711 CACTGCAGCCTCCGCTGCCCGGG + Intronic
1165241307 19:34470596-34470618 CACTGCAGCCTCCGCCTTCCAGG + Exonic
1165962302 19:39545343-39545365 CGCTGCAGCCTCCGCTCTTCAGG + Intergenic
1166210367 19:41302903-41302925 CGCTGCCTCCCCCTCGGTTCTGG - Exonic
1166366387 19:42280559-42280581 CGCTGCCGCGTCCTCGGGCTGGG + Intronic
1166393038 19:42420671-42420693 CACTGCCTCCTCCCTGGTCCAGG + Intronic
1166517197 19:43456270-43456292 CACTGCAGCCTCCGCCTTCCGGG + Intergenic
1166547181 19:43640394-43640416 AGCTGCAGCCTCCCCTGTCCCGG - Intergenic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1167018365 19:46856635-46856657 GGCAGCCGCCTCCGCGCACCCGG - Intergenic
1167045921 19:47048528-47048550 TACTGCCGCCTCAGCGGCCCCGG - Exonic
1167413459 19:49358337-49358359 CACTGCAGCCTCCGCCTTCCGGG - Intronic
1167712480 19:51120919-51120941 CACTGCAGCCTCCGCCTTCCAGG + Intergenic
1168073069 19:53963337-53963359 CGCCGCCGCCCCCGCGGTGGGGG - Exonic
1168396239 19:56051266-56051288 CACTGCAACCTCCGCGTTCCAGG + Intronic
1168423130 19:56217949-56217971 CGCTGCCGCCAACGCGGGCATGG - Intergenic
1168721420 19:58556841-58556863 AGCTGCTGCCTCCTCTGTCCAGG + Intronic
926122022 2:10246560-10246582 CACTGCAGCCTCCTCGTTCCGGG - Intergenic
927168454 2:20348851-20348873 CACTGCAGCCTCCGCGTCCCGGG - Intronic
927540481 2:23906263-23906285 CACTGCAGCCTCCGCCTTCCAGG - Intronic
927698303 2:25252142-25252164 CCCTGCCGCCTCCCCGCCCCCGG + Intronic
927964970 2:27262831-27262853 CTCCGGCGCCACCGCGGTCCCGG + Exonic
928093440 2:28390489-28390511 CTCCGCGGCCTCCGCAGTCCCGG - Intergenic
929144892 2:38698017-38698039 CACTGCAGCCTCCGCCTTCCGGG + Intronic
929950810 2:46408378-46408400 TGCTGCAGTCTCCCCGGTCCTGG - Intergenic
929983220 2:46699572-46699594 CGCTGCCTCCGCCGCGGTGCGGG - Intronic
930314927 2:49785966-49785988 CACTGCAACCTCCGCTGTCCGGG + Intergenic
930669711 2:54135971-54135993 CACTGCAGCCTCCGCCTTCCAGG + Intronic
931342278 2:61413313-61413335 CACTGCAGCCTCCGCCTTCCAGG - Intronic
931342358 2:61413853-61413875 CACTGCAGCCTCCGCCTTCCAGG - Intronic
931523043 2:63120600-63120622 CACTGCAGCCTCCGCCCTCCGGG + Intergenic
931724550 2:65096075-65096097 CGCTGCAGCCTCCGCCTCCCAGG - Intronic
932827928 2:74958675-74958697 CGCCGCCGCCGCCGCCATCCCGG - Exonic
933566568 2:83957547-83957569 CGCTGCAACCTCCGCTGCCCGGG - Intergenic
934079060 2:88452307-88452329 CGCAGCCGCCGCCGCGTACCTGG - Exonic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
934686441 2:96325314-96325336 CGCAGCCGCTCCCGCCGTCCGGG - Intronic
934921128 2:98346430-98346452 CGCTCCCTCCCCCGCGCTCCCGG - Exonic
935592617 2:104855837-104855859 CGCTGCCGCCGCCGCCGCCGTGG + Exonic
935592778 2:104856383-104856405 CGCCGCCGCCGCCGTGGTGCGGG - Exonic
936531148 2:113277860-113277882 CGCTGCCGGCTCCCGGGCCCGGG + Intronic
937688110 2:124721404-124721426 CACTGCAACCTCCGCCGTCCGGG - Intronic
937986970 2:127642306-127642328 CGCTGCCGCCTCGGCTCTGCAGG - Intronic
941021030 2:160407917-160407939 CGCTGCCGCCTCCCCGCCCCCGG - Intronic
941476513 2:165957009-165957031 CGCTGCAGTCTCGGCGGGCCGGG - Intergenic
942027209 2:171922343-171922365 CGCTTCCGCCGCCGGGCTCCTGG + Intronic
942748719 2:179264623-179264645 CGCTGCTGCCGCCGCCGCCCGGG - Exonic
943571511 2:189580777-189580799 CGCCGCCGCCGCCGTGGGCCGGG + Exonic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
944447383 2:199805207-199805229 CCCTGCAGCCTCCTCAGTCCAGG + Intronic
945245336 2:207712006-207712028 CGCTACCGCCACCGCGTCCCCGG - Exonic
946191646 2:218010687-218010709 TGCTGCCGCCGCCGCCGCCCCGG - Intergenic
946422083 2:219570861-219570883 CGCTGCCATCGCCGGGGTCCGGG - Exonic
947549688 2:231037526-231037548 CTCTGCGGCCGCCGCGGCCCGGG - Exonic
948090492 2:235289889-235289911 CACTGCAACCTCCGCCGTCCTGG - Intergenic
948140476 2:235669506-235669528 CGCCGCCGCCGCCGCGCTCCCGG + Intronic
948467434 2:238159067-238159089 GGCCGCCGCCGCCGCGGGCCTGG + Exonic
948825381 2:240571268-240571290 GGCTGCCTCCCCCGCAGTCCCGG - Intronic
948937345 2:241175852-241175874 CACTGCAGCCTCCGCTTTCCAGG + Intronic
1169171827 20:3471349-3471371 CGCCGCCGCCGCCGCGGCCTCGG - Exonic
1169376621 20:5071545-5071567 CACTGCAACCTCCGCCGTCCGGG - Intronic
1169800338 20:9507089-9507111 CGCCGCCGCCTCCGCCGCCTGGG + Intergenic
1170620513 20:17991906-17991928 CACTGCAGCCTCCGCCTTCCGGG + Intronic
1171346724 20:24470857-24470879 CGCTGGCGCCGCGGCGCTCCTGG + Intronic
1171810218 20:29741202-29741224 CGTGGCCACCACCGCGGTCCTGG - Intergenic
1171908756 20:30921971-30921993 CGTGGCCACCACCGCGGTCCGGG + Intergenic
1171956320 20:31466522-31466544 CACTGCAGCCTCCGCCTTCCGGG - Intronic
1172037308 20:32019118-32019140 CGCCGCCGCCTCCCCCGGCCCGG - Exonic
1172168727 20:32915745-32915767 CACTGCAGCCTCCGCGTCCCGGG + Intronic
1172418986 20:34797810-34797832 AGCTGCCGCCTCCCAGGTTCAGG - Intronic
1172429293 20:34876604-34876626 CGCGGCCGCCTTTGCGGTCGCGG - Exonic
1172500557 20:35423662-35423684 CACTGCAGCCTCCGCTTTCCAGG + Intergenic
1172568938 20:35954068-35954090 AGCTGCGGCCTCCGCGGCCCTGG - Exonic
1173672872 20:44810292-44810314 CGCCGCCGCCGCCGCGGCCGAGG - Intronic
1174330408 20:49812964-49812986 CCCCGCCGCCTCCGCCGCCCGGG - Intronic
1174494729 20:50931307-50931329 CGCCGCCGCCTCCGCCGGCCCGG - Intergenic
1175003391 20:55655082-55655104 CGCTGCAACCTCCGCCTTCCAGG - Intergenic
1175873672 20:62219854-62219876 CGCGGCCAGCACCGCGGTCCAGG + Exonic
1176175013 20:63717423-63717445 CACTGCAGCCTCCGCCGCCCAGG + Intronic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1178992543 21:37367418-37367440 GGCTGTCGCCTCCCCGGCCCCGG + Intronic
1180053771 21:45346362-45346384 CGCTGCCGTCTCCGCCTCCCAGG + Intergenic
1180071561 21:45439287-45439309 CGCTGCGCCCTCCGCGCCCCTGG - Intronic
1180650525 22:17372590-17372612 CGCTGCCACCTCCGCCTACCGGG - Intronic
1180891407 22:19291655-19291677 CGCTGCCGCCGCCGCCGCCGAGG - Exonic
1181147397 22:20858692-20858714 CGCCTCCGCCTCCCCGGGCCGGG + Exonic
1181547205 22:23608866-23608888 GGCTCCCGCCTCTGCAGTCCAGG + Intronic
1182447221 22:30396984-30397006 GGCTGCCAGCTCCGCGGCCCGGG + Exonic
1182586357 22:31346196-31346218 CGCCGCCGCCACCGCCCTCCAGG - Exonic
1182637930 22:31743724-31743746 CACTGCAGCCTCCGCCTTCCAGG - Intronic
1183247212 22:36703231-36703253 CGCCGCCGCCGCCGCTGCCCGGG - Exonic
1183702502 22:39457990-39458012 GGCTGCCGCCGCCGCAGTCTGGG - Intronic
1184273897 22:43399626-43399648 CGCTGCCACCTCCAGGCTCCAGG - Intergenic
1184523365 22:45008354-45008376 CCCTGCCGCCTCCGAGAACCCGG + Intronic
1184563173 22:45275202-45275224 CACTGCAGCCTCCGCCTTCCAGG + Intergenic
1184766949 22:46577127-46577149 CGCCGCCGCCTCCGCGCTCGTGG + Intronic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1185313821 22:50170427-50170449 CGCCGCCGCCCCCGGGGTCAGGG - Intergenic
950084666 3:10248762-10248784 GGCTGCCGGATCCGCGGCCCCGG - Exonic
950376702 3:12578394-12578416 CACTGCCACCTCCGCCTTCCAGG + Intronic
951871568 3:27368214-27368236 CACTGCAGCCTCCGCCTTCCGGG - Intronic
951987017 3:28632400-28632422 CGCTGCAGCCTCCGCCCCCCAGG + Intergenic
953431749 3:42845771-42845793 CACTGCAGCCTCCGCCTTCCAGG - Intronic
954217788 3:49133904-49133926 GCCTGCCGCCTCCACAGTCCCGG + Intergenic
954677719 3:52324943-52324965 CCCTGCTGCGTCCGCGGGCCGGG - Intronic
954829749 3:53410426-53410448 CACTGCAACCTCCGCGTTCCGGG + Intergenic
958429259 3:94018839-94018861 CACTGCAACCTCCGCCGTCCGGG + Intronic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
961202401 3:125055578-125055600 CGCTCCCGCCTCTGGGGGCCCGG + Exonic
961762723 3:129183608-129183630 TGCTGCCGCCGCCTCGGACCCGG - Intronic
964999774 3:162939437-162939459 CACTGCAGCCTCCGCCTTCCAGG + Intergenic
965560973 3:170062263-170062285 CGCTGCTGCCTCCGCCGCACGGG - Intronic
966136411 3:176704154-176704176 CGCTGCCATCTCCGCCTTCCAGG - Intergenic
966202119 3:177368299-177368321 CACTGCAGCCTCCGCCTTCCGGG + Intergenic
966776476 3:183546985-183547007 CTCTGCAACCTCCGCCGTCCGGG + Intronic
966860656 3:184229644-184229666 TGGTGCCGCCTCTGCGCTCCGGG - Intronic
967171752 3:186827438-186827460 TTCTGCCGCCGCCGCGGCCCCGG - Intergenic
967291598 3:187926179-187926201 CGCTGCAACCTCCGCCTTCCAGG - Intergenic
967590079 3:191262140-191262162 CACTGCAGCCTCCGCCTTCCGGG - Intronic
967685281 3:192409913-192409935 CGCCGCCGCCTCCCCAGGCCCGG + Intronic
968131279 3:196194218-196194240 CGCTGCCCCATCCCTGGTCCTGG - Intergenic
968384603 4:124935-124957 CGCGGCGGCCTGCGCGGTGCCGG + Exonic
968514858 4:1011734-1011756 CCCCGCCGCCTGCCCGGTCCGGG + Intronic
968583698 4:1406337-1406359 CGCTCCCGCCGCCGCTGCCCAGG - Intergenic
968975383 4:3819704-3819726 CGCTGCCTCCCCAGCGGGCCCGG - Intergenic
969085661 4:4654448-4654470 CACTGCAACCTCCGCGTTCCGGG - Intergenic
969409846 4:7020774-7020796 CGCTGCAGCCTCCGCCTCCCAGG + Intronic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
971319648 4:25595104-25595126 CGCTGCAACCTCCGCCCTCCAGG - Intergenic
971757558 4:30721971-30721993 TGCCGCCGCCTCCGGGCTCCTGG - Exonic
976410834 4:84711773-84711795 CACTGCAGCCTCCGCGTCCCAGG - Intronic
978341060 4:107721371-107721393 ACCTGCGGCCTCCCCGGTCCTGG - Intergenic
978689350 4:111487428-111487450 CACTGCAGCCTCCGCCTTCCGGG - Intergenic
979685316 4:123505639-123505661 CGCTGCCGCCGCCGCCGCCGAGG + Intergenic
979785647 4:124712702-124712724 CGCCGCCGCCGCCGCCGTCAGGG + Exonic
981270744 4:142845723-142845745 CGCCGCCGCCGCCGCCGGCCTGG - Intronic
982037172 4:151357054-151357076 CACTGCAGCCTCCGCCTTCCAGG + Intergenic
982460970 4:155667857-155667879 CCCTGCTGCCTCCGGGGTCCAGG - Intronic
982696509 4:158608361-158608383 CACTGCAGCCTCCGCCTTCCAGG + Intronic
985255826 4:188069026-188069048 CGCTGCAACCTCCGCCTTCCGGG - Intergenic
985532666 5:443184-443206 TGCCTCCGCCTCCGGGGTCCCGG - Exonic
985552025 5:538587-538609 CGATGCCGCCTCAGCCGCCCAGG + Intergenic
986636253 5:9824769-9824791 CGCTGCAACCTCCGCTGCCCAGG - Intergenic
987093120 5:14524988-14525010 CACTGCAGCCTCCGCCTTCCGGG - Intronic
987561186 5:19522817-19522839 CGCTGCAGCCTCCGCCTCCCAGG - Intronic
988241096 5:28610236-28610258 CGCTGCAGCCTCCGCCTCCCAGG + Intergenic
990421486 5:55639195-55639217 CGCTGCAACCTCCGCCTTCCCGG - Intronic
992105521 5:73447213-73447235 CGCTGCCGCCGCCGCCGCGCAGG - Exonic
992134537 5:73730607-73730629 CGCTGCAGCCTCAGCCTTCCTGG + Intronic
993009559 5:82464445-82464467 CACTGCCGCCTCCGCCTCCCGGG - Intergenic
994508664 5:100675152-100675174 CCCTGCAGCCTCCGCCTTCCAGG + Intergenic
995048173 5:107672470-107672492 CGCTGCTGCCGCTGCGGCCCGGG + Intergenic
996535144 5:124570051-124570073 CACTGCCTCCACCGTGGTCCAGG - Intergenic
998228894 5:140346705-140346727 CGCTGCCGGCGCCGCGAGCCGGG - Intergenic
999004697 5:147962770-147962792 CACTGCAGCCTCCGCCTTCCAGG + Intergenic
999786783 5:154897973-154897995 CGCTGCAACCTCCGCCTTCCGGG + Intronic
1000319080 5:160119359-160119381 CGCTGCCGCCTCTGCAGCCACGG + Exonic
1001496026 5:172188227-172188249 CGCCGCCGCCTGCGCGGTTCCGG - Exonic
1001615282 5:173038261-173038283 CACTGCAGCCTCCGCCTTCCAGG - Intergenic
1002293787 5:178217300-178217322 AGCTGCCGCCTCCCAGGTTCAGG + Intronic
1002336339 5:178481070-178481092 CGCTGCAGCCTCCGCCTCCCGGG - Intronic
1002384845 5:178858803-178858825 CACTGCCACCTCCGCCTTCCAGG - Intergenic
1002456016 5:179345649-179345671 CGCCGCCGTCGCCGCGGTGCCGG + Intergenic
1002888012 6:1312761-1312783 CGCTGCCGCCCGCGCCCTCCAGG - Exonic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1003024005 6:2537413-2537435 CGCTGCCACCTCAGCCTTCCAGG + Intergenic
1003645535 6:7910648-7910670 CGCCGCCGCCTCCTGGGCCCGGG + Exonic
1005596348 6:27381956-27381978 CGCTGCAACCTCCGCCTTCCAGG - Intronic
1006617944 6:35342571-35342593 CGCTGCGGCCGCCGCGGACCTGG + Intronic
1009292517 6:61902029-61902051 CACTGCCGCCTCCGCTTCCCGGG + Intronic
1013117652 6:107115046-107115068 CGCTGCCGCCGCCGCGCGGCCGG + Intronic
1013272687 6:108558636-108558658 CCCAGCCGCCTCCGGGCTCCGGG - Intergenic
1015244510 6:131062507-131062529 AGCTGCCGCCTGCGCCGTCTGGG - Intronic
1017009064 6:150050402-150050424 CACTGCCACCTCCGCCTTCCTGG - Intergenic
1018686661 6:166308549-166308571 CGCTCCGCCCTCCGCTGTCCTGG - Intergenic
1019279526 7:192921-192943 CGCGCCCGGCTCCGCGGACCAGG + Intergenic
1019435474 7:1020240-1020262 CGCTGCAGCCTCTGCCCTCCTGG + Intronic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1019508874 7:1407299-1407321 CACTGCAGCCTCCGTGCTCCCGG + Intergenic
1019562634 7:1666080-1666102 CGCCGCCGCCGCCGCGCTCGGGG + Intergenic
1019570229 7:1707977-1707999 CTCTGCCGCATCCGCGCCCCTGG - Intronic
1019671179 7:2279675-2279697 CACTGCAGCCTCCGCCTTCCCGG - Intronic
1019824073 7:3268926-3268948 CGCTGCAACCTCCGCCTTCCAGG - Intergenic
1019997213 7:4732366-4732388 CACTGCGGCCTCCGCTGCCCAGG + Intronic
1020095929 7:5369271-5369293 CACTGCAGCCTCCGCCCTCCCGG - Intronic
1021685917 7:23185813-23185835 CGCTGCAGCCTCCGCCTTCTGGG + Intronic
1021886796 7:25147216-25147238 CACTGCAGCCTCCGCCTTCCGGG - Intronic
1023290661 7:38665472-38665494 CGCTGCAACCTCCGCCTTCCGGG - Intergenic
1023462241 7:40411315-40411337 CACTGCAGCCTCCGCTGCCCAGG - Intronic
1023692687 7:42807699-42807721 CACTGCAGCCTCCGCCTTCCAGG - Intergenic
1025091706 7:56069675-56069697 CGCTGCAGCCTCTGCGTCCCAGG + Intronic
1025218164 7:57077649-57077671 CACTGCAGCCTCCGCCGCCCGGG - Intergenic
1025629077 7:63251267-63251289 CACTGCAGCCTCCGCCGCCCGGG - Intergenic
1025653181 7:63492804-63492826 CACTGCAGCCTCCGCCGCCCGGG + Intergenic
1025733002 7:64122917-64122939 CACTGCCACCTCCGCCTTCCAGG - Intronic
1026360505 7:69598238-69598260 CGCTCCCGCCCCCGCGGCCCCGG - Intergenic
1026760938 7:73125201-73125223 CGCTGCTGCCTCACTGGTCCTGG + Intergenic
1026843333 7:73683157-73683179 CTCGGCGGCCTCCGCGCTCCCGG + Exonic
1026940034 7:74282457-74282479 CACTGCAGCCTCCGCCGCCCGGG + Intergenic
1027037280 7:74933997-74934019 CGCTGCTGCCTCACTGGTCCTGG + Intergenic
1027086282 7:75267455-75267477 CGCTGCTGCCTCACTGGTCCTGG - Intergenic
1028214112 7:88110816-88110838 CGCTGCAGCCTCCGCCTCCCAGG + Intronic
1029372600 7:100158769-100158791 CGCCCCCTCCTCCACGGTCCGGG - Intergenic
1029392585 7:100285482-100285504 CGCTGCTGCCTCACTGGTCCTGG - Intergenic
1029419530 7:100465712-100465734 CCCTGCAGCCTCCACGTTCCTGG - Intronic
1029553507 7:101251707-101251729 CACTGCAGCCTCCGCCTTCCGGG - Intronic
1029569918 7:101362757-101362779 CACTGCCGCCTCCTCGGCCCCGG + Intergenic
1029640034 7:101815220-101815242 CGCTGGCACCGCCGCTGTCCGGG + Intergenic
1030031307 7:105372057-105372079 CACTGCGGCCTCCGCCTTCCGGG - Intronic
1031043449 7:116862571-116862593 CGCTGCCGCCGCCGCCGCCGCGG + Exonic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1032145470 7:129375830-129375852 CACTGCCACCTCTGTGGTCCAGG - Intronic
1033367056 7:140679746-140679768 CACTGCCACCTCCGCCTTCCAGG + Intronic
1034306284 7:150047674-150047696 CGCCGCCGCCGCCGCGCTCCCGG + Intergenic
1034492620 7:151401970-151401992 CACTGCAGCCTCCGCCTTCCGGG - Intronic
1034522669 7:151632440-151632462 CGCTGCCGCCCTCGAGCTCCCGG - Intronic
1034800563 7:154052979-154053001 CGCCGCCGCCGCCGCGCTCCCGG - Intronic
1035280488 7:157775463-157775485 CGCTGCCGCCTCCGCCCTGTGGG - Intronic
1035596507 8:862376-862398 CACTGCGGCCTCCGCCTTCCGGG + Intergenic
1036464207 8:8981281-8981303 CACTGCAGCCTCCGCCGCCCAGG + Intergenic
1036692340 8:10951835-10951857 CCCTGCCCCCTCCTTGGTCCGGG - Intronic
1036789502 8:11708672-11708694 CGCCGCCGCTGCCGCGGCCCGGG + Exonic
1037305143 8:17496999-17497021 CACCGCCTCCTCCGCGCTCCCGG - Intergenic
1037884541 8:22589312-22589334 CGCTGGCGACTCGGCGGTGCTGG + Exonic
1037902499 8:22695763-22695785 CGCTGTGGGGTCCGCGGTCCTGG + Intergenic
1038554124 8:28494566-28494588 CCCAGCCGCCACCGCGGGCCCGG - Intronic
1038849429 8:31260962-31260984 CACTGCCACCTCCGCCGCCCGGG + Intergenic
1041240808 8:55847750-55847772 CACTGCAGCCTCCGCCTTCCGGG + Intergenic
1041355307 8:56993650-56993672 CGCCGCAGCCGCCGCGCTCCGGG + Exonic
1041552684 8:59119264-59119286 CGCTGCCGCCGCCGCCGGGCAGG + Intergenic
1042040033 8:64580726-64580748 CGCCGCCGCCGCCTCGGCCCCGG - Exonic
1042040035 8:64580732-64580754 CGCTGCCGCCGCCGCCGCCTCGG - Exonic
1042273289 8:66977579-66977601 CACTGCAGCCTCCGCCTTCCAGG + Intronic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1045564365 8:103298796-103298818 CGCCGCCGCCGCCGCGAGCCCGG + Intronic
1045738011 8:105318838-105318860 CGCCGCCGCCGCCGCTGGCCAGG - Exonic
1046103901 8:109644685-109644707 CGCCGCCGCTGCCGCCGTCCAGG + Exonic
1047066526 8:121290588-121290610 CACTGCAGCCTCCGCCTTCCAGG + Intergenic
1047363128 8:124187585-124187607 CACTGCCGCCTCCGCGCCCTGGG - Intergenic
1048038724 8:130704286-130704308 CGCTGCAGCCTCCGCCTCCCAGG - Intergenic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1049194517 8:141308109-141308131 CCCCGCCGCCCCCGCGGCCCCGG - Intronic
1049642313 8:143721236-143721258 CGCTGCTGCCTCCACACTCCAGG - Exonic
1049724261 8:144138191-144138213 GGCGGCCGCCTCCTCGGCCCAGG - Exonic
1049788577 8:144462775-144462797 CGCCGCCGCCTCAGTGGGCCCGG + Intronic
1049828543 8:144685538-144685560 CGCTGCAGTCGCCGCGGGCCTGG + Intergenic
1049828562 8:144685603-144685625 CGCTGCGGTCCCCGTGGTCCTGG - Intergenic
1050295877 9:4204836-4204858 CGCTGCAACCTCCGCCTTCCGGG - Intronic
1050625069 9:7494739-7494761 CACTGCAGCCTCCGCCTTCCTGG + Intergenic
1051171572 9:14322712-14322734 CGCTCCCGCCTCCCGGGTCCCGG - Intronic
1051351047 9:16198158-16198180 TGCTGCCGCCGCCGCTGCCCTGG + Intergenic
1051643321 9:19244104-19244126 CACTGCCGCCTCCGCCTCCCGGG + Intronic
1053434908 9:38068291-38068313 CGCTGCCGCCGCAGTAGTCCAGG + Exonic
1054798675 9:69325549-69325571 CGCCGCTGCCGCCGCGGCCCCGG + Intronic
1055090984 9:72364790-72364812 TGGTGCCGCCGCCGCGGGCCGGG + Intronic
1055092992 9:72381422-72381444 CGCTGCAGCCTCCGCCTCCCGGG - Intergenic
1055611890 9:78031962-78031984 CGCCGCCGCCTCCTCCCTCCCGG - Intergenic
1057259764 9:93576983-93577005 CGCCGCCGCCGCCGCATTCCGGG + Intronic
1057489129 9:95508310-95508332 TGCCGCCGCCGCCGCGGTCCTGG + Exonic
1057796479 9:98161476-98161498 CGCTGCAACCTCCGCATTCCCGG - Intronic
1057869777 9:98708894-98708916 CGCTGCCGCCGCCGCCGCCGCGG - Exonic
1058052043 9:100416240-100416262 CACTGCCACCTCCGCCTTCCGGG - Intergenic
1059769782 9:117414623-117414645 CGCCGCCGCCGCCGCGTCCCCGG - Exonic
1061015935 9:127980815-127980837 CGCCGCCTCCTCCTCGATCCTGG + Intergenic
1061029937 9:128075059-128075081 CACTGCAGCCTCCGCTGCCCGGG - Intronic
1061283642 9:129610582-129610604 CGCCTCCGCCTCCGCGCTGCTGG - Intronic
1061559676 9:131394349-131394371 CGCGGCCGCCGCCGGGGGCCCGG + Intronic
1061683353 9:132255488-132255510 CACTGCAGCCTCCGCTGCCCTGG - Intergenic
1061805641 9:133136292-133136314 CGCTGCCCCCTCAGCCCTCCTGG - Intronic
1062230604 9:135479809-135479831 CGCTGCCGCCGCCCCGCGCCCGG - Exonic
1062305812 9:135906846-135906868 GCCGGCCGCCTCCGAGGTCCTGG - Intronic
1062341574 9:136095760-136095782 CGGTGCAGCCTCCGGGATCCGGG + Intergenic
1062476015 9:136727954-136727976 CGGCGCCTCCTCCGCGGCCCGGG + Intergenic
1062654144 9:137593572-137593594 CGCTGCCACCTCCGCCTCCCGGG + Intergenic
1185665471 X:1761951-1761973 CGCTGCAACCTCCGCCCTCCCGG + Intergenic
1185677286 X:1859139-1859161 CGCTGCCGCCTCCGCCTCCGAGG - Intergenic
1186002415 X:5027610-5027632 CGCTGCCACCTCCGCCTCCCAGG - Intergenic
1186496424 X:10015484-10015506 CGCGGCCGCCCCCGCGCCCCGGG + Intergenic
1187975254 X:24698727-24698749 CGCTGCAGCCTCCGCCTCCCGGG + Intronic
1189324667 X:40105336-40105358 CGCCGCCGCCGCCGCAGTCACGG + Intronic
1189325561 X:40109015-40109037 CGCCGCCGCCGCCGCGTTCCCGG - Intronic
1194421061 X:93673395-93673417 CGCTGCCACCTCCGCAGCCCGGG - Exonic
1194821455 X:98511767-98511789 CGCTGCAGCCTCCGCCTCCCAGG - Intergenic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic
1196696777 X:118621707-118621729 CGCTGCAGCCTCCGCCTCCCGGG + Intronic
1196915538 X:120531244-120531266 CACTGCAGCCTCCGCCTTCCAGG - Intronic
1198530603 X:137547391-137547413 CGCCTGCGCCACCGCGGTCCGGG - Intergenic
1199834987 X:151581150-151581172 CGCTGCCACCTCCGCCTCCCAGG - Intronic